EMAIL THIS PAGE TO A FRIEND

BTN3A3

butyrophilin, subfamily 3, member A3

43 Gene Product Result for
Synonyms: BTF3
UniProtKB ID: O00478, B4DWI7, E9PCP5
Gene ID:
Human(10384) Summary: The butyrophilin (BTN) genes are a group of major histocompatibility complex (MHC)-associated genes that encode type I membrane proteins with 2 extracellular immunoglobulin (Ig) domains and an intracellular B30.2 (PRYSPRY) domain. Three subfamilies of human BTN genes are located in the MHC class I region: the single-copy BTN1A1 gene (MIM 601610) and the BTN2 (e.g., BTN2A1; MIM 613590) and BTN3 (e.g., BNT3A3) genes, which have undergone tandem duplication, resulting in 3 copies of each (summary by Smith et al., 2010 [PubMed 20208008]
sheep(101103275) butyrophilin, subfamily 3, member A3
chicken(101668208) butyrophilin, subfamily 3, member A3
cow(786760) butyrophilin, subfamily 3, member A3
chicken(101751667) butyrophilin, subfamily 3, member A3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006994 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006994 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006994 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006994 Rosetta Predictions human pricing
NM_197974 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006994 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072143 predicted 1149
2 SASI_Hs01_00072145 predicted 1145
3 SASI_Hs01_00072146 predicted 1581
4 SASI_Hs01_00072147 predicted 699
5 SASI_Hs01_00072148 predicted 1623
6 SASI_Hs01_00072149 predicted 625
7 SASI_Hs01_00072144 predicted 1031
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197974 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214733 predicted 1064
2 SASI_Hs01_00214735 predicted 1049
3 SASI_Hs01_00214736 predicted 1494
4 SASI_Hs01_00214737 predicted 610
5 SASI_Hs01_00214738 predicted 1534
6 SASI_Hs01_00214739 predicted 540
7 SASI_Hs01_00214734 predicted 942
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006994
BTN3A3 MISSION shRNA Bacterial Glycerol Stock
butyrophilin, subfamily 3, member A3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006994.4-2438s21c1
Sequence:CCGGGCTGCAGGGTAGAGATCATTTCTCGAGAAATGATCTCTACCCTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006994.4-2238s21c1
Sequence:CCGGCCCTGTCGGGTAGTCATATTTCTCGAGAAATATGACTACCCGACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006994.4-1254s21c1
Sequence:CCGGCAAACCTGCGGATGTGATTCTCTCGAGAGAATCACATCCGCAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006994.4-2341s21c1
Sequence:CCGGGCCTTAGTCCCTGGCTAATTGCTCGAGCAATTAGCCAGGGACTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006994.3-2665s1c1
Sequence:CCGGCCCTAGAGATTCTCTGTGATACTCGAGTATCACAGAGAATCTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006994.3-1065s1c1
Sequence:CCGGCGCTGCAACAGAGCAAGAAATCTCGAGATTTCTTGCTCTGTTGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006994.3-1150s1c1
Sequence:CCGGGAGAAGTCTTTGGCCTATCATCTCGAGATGATAGGCCAAAGACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006994.3-1882s1c1
Sequence:CCGGGCAACAACCAATCAGAACCATCTCGAGATGGTTCTGATTGGTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006994.3-631s1c1
Sequence:CCGGCACATTGAAGTGAAGGGTTATCTCGAGATAACCCTTCACTTCAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006994
BTN3A3 MISSION shRNA shRNA Plasmid DNA
butyrophilin, subfamily 3, member A3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006994.4-2438s21c1
Sequence:CCGGGCTGCAGGGTAGAGATCATTTCTCGAGAAATGATCTCTACCCTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006994.4-2238s21c1
Sequence:CCGGCCCTGTCGGGTAGTCATATTTCTCGAGAAATATGACTACCCGACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006994.4-1254s21c1
Sequence:CCGGCAAACCTGCGGATGTGATTCTCTCGAGAGAATCACATCCGCAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006994.4-2341s21c1
Sequence:CCGGGCCTTAGTCCCTGGCTAATTGCTCGAGCAATTAGCCAGGGACTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006994.3-2665s1c1
Sequence:CCGGCCCTAGAGATTCTCTGTGATACTCGAGTATCACAGAGAATCTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006994.3-1065s1c1
Sequence:CCGGCGCTGCAACAGAGCAAGAAATCTCGAGATTTCTTGCTCTGTTGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006994.3-1150s1c1
Sequence:CCGGGAGAAGTCTTTGGCCTATCATCTCGAGATGATAGGCCAAAGACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006994.3-1882s1c1
Sequence:CCGGGCAACAACCAATCAGAACCATCTCGAGATGGTTCTGATTGGTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006994.3-631s1c1
Sequence:CCGGCACATTGAAGTGAAGGGTTATCTCGAGATAACCCTTCACTTCAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006994
BTN3A3 MISSION shRNA Lentiviral Transduction Particles
butyrophilin, subfamily 3, member A3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006994.4-2438s21c1
Sequence:CCGGGCTGCAGGGTAGAGATCATTTCTCGAGAAATGATCTCTACCCTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006994.4-2238s21c1
Sequence:CCGGCCCTGTCGGGTAGTCATATTTCTCGAGAAATATGACTACCCGACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006994.4-1254s21c1
Sequence:CCGGCAAACCTGCGGATGTGATTCTCTCGAGAGAATCACATCCGCAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006994.4-2341s21c1
Sequence:CCGGGCCTTAGTCCCTGGCTAATTGCTCGAGCAATTAGCCAGGGACTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006994.3-2665s1c1
Sequence:CCGGCCCTAGAGATTCTCTGTGATACTCGAGTATCACAGAGAATCTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006994.3-1065s1c1
Sequence:CCGGCGCTGCAACAGAGCAAGAAATCTCGAGATTTCTTGCTCTGTTGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006994.3-1150s1c1
Sequence:CCGGGAGAAGTCTTTGGCCTATCATCTCGAGATGATAGGCCAAAGACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006994.3-1882s1c1
Sequence:CCGGGCAACAACCAATCAGAACCATCTCGAGATGGTTCTGATTGGTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006994.3-631s1c1
Sequence:CCGGCACATTGAAGTGAAGGGTTATCTCGAGATAACCCTTCACTTCAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks