EMAIL THIS PAGE TO A FRIEND

BTNL10

butyrophilin-like 10

44 Gene Product Result for
Synonyms: BUTR1
UniProtKB ID: A8MVZ5
Gene ID:
Mouse(192194) butyrophilin-like 10
naked mole-rat(101722697) butyrophilin-like 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138678 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138678 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138678 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001721883 Rosetta Predictions human pricing
XM_001722031 Rosetta Predictions human pricing
XM_001722254 Rosetta Predictions human pricing
NM_138678 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721883 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00445669 predicted 675
2 SASI_Hs02_00445670 predicted 250
3 SASI_Hs02_00445671 predicted 204
4 SASI_Hs02_00445672 predicted 359
5 SASI_Hs02_00445673 predicted 218
6 SASI_Hs02_00445674 predicted 215
7 SASI_Hs02_00445675 predicted 246
8 SASI_Hs02_00445676 predicted 216
9 SASI_Hs02_00445677 predicted 351
10 SASI_Hs02_00445678 predicted 642
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001722031 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00446697 predicted 681
2 SASI_Hs02_00446698 predicted 249
3 SASI_Hs02_00446699 predicted 211
4 SASI_Hs02_00446700 predicted 360
5 SASI_Hs02_00446701 predicted 221
6 SASI_Hs02_00446702 predicted 216
7 SASI_Hs02_00446703 predicted 252
8 SASI_Hs02_00446704 predicted 219
9 SASI_Hs02_00446705 predicted 346
10 SASI_Hs02_00446706 predicted 641
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001722254 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00448042 predicted 675
2 SASI_Hs02_00448043 predicted 244
3 SASI_Hs02_00448044 predicted 206
4 SASI_Hs02_00448045 predicted 356
5 SASI_Hs02_00448046 predicted 217
6 SASI_Hs02_00448047 predicted 216
7 SASI_Hs02_00448048 predicted 246
8 SASI_Hs02_00448049 predicted 219
9 SASI_Hs02_00448050 predicted 349
10 SASI_Hs02_00448051 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138678 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061078 predicted 326
2 SASI_Mm01_00061080 predicted 509
3 SASI_Mm01_00061081 predicted 204
4 SASI_Mm01_00061082 predicted 663
5 SASI_Mm01_00061083 predicted 468
6 SASI_Mm01_00061084 predicted 403
7 SASI_Mm01_00061085 predicted 486
8 SASI_Mm01_00061086 predicted 792
9 SASI_Mm01_00061087 predicted 412
10 SASI_Mm02_00339757 predicted 690
11 SASI_Mm01_00061079 predicted 707
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138678
BTNL10 MISSION shRNA Bacterial Glycerol Stock
butyrophilin-like 10
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138678.1-829s1c1
Sequence:CCGGGAACAGGACACTGGATTCCTTCTCGAGAAGGAATCCAGTGTCCTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138678.1-186s1c1
Sequence:CCGGCAGCTTCATCTTCCTGCAACTCTCGAGAGTTGCAGGAAGATGAAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138678.1-278s1c1
Sequence:CCGGGTCAAGACAAAGAGTTGCCCTCTCGAGAGGGCAACTCTTTGTCTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138678.1-709s1c1
Sequence:CCGGGCTGAGAGTCACTTCTCAGTTCTCGAGAACTGAGAAGTGACTCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138678.2-496s21c1
Sequence:CCGGGTGTTTGACAACGGGACTTATCTCGAGATAAGTCCCGTTGTCAAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138678.2-256s21c1
Sequence:CCGGCACCCACTTCTGGCCATAGTTCTCGAGAACTATGGCCAGAAGTGGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138678
BTNL10 MISSION shRNA shRNA Plasmid DNA
butyrophilin-like 10
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138678.1-829s1c1
Sequence:CCGGGAACAGGACACTGGATTCCTTCTCGAGAAGGAATCCAGTGTCCTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138678.1-186s1c1
Sequence:CCGGCAGCTTCATCTTCCTGCAACTCTCGAGAGTTGCAGGAAGATGAAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138678.1-278s1c1
Sequence:CCGGGTCAAGACAAAGAGTTGCCCTCTCGAGAGGGCAACTCTTTGTCTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138678.1-709s1c1
Sequence:CCGGGCTGAGAGTCACTTCTCAGTTCTCGAGAACTGAGAAGTGACTCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138678.2-496s21c1
Sequence:CCGGGTGTTTGACAACGGGACTTATCTCGAGATAAGTCCCGTTGTCAAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138678.2-256s21c1
Sequence:CCGGCACCCACTTCTGGCCATAGTTCTCGAGAACTATGGCCAGAAGTGGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138678
BTNL10 MISSION shRNA Lentiviral Transduction Particles
butyrophilin-like 10
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138678.1-829s1c1
Sequence:CCGGGAACAGGACACTGGATTCCTTCTCGAGAAGGAATCCAGTGTCCTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138678.1-186s1c1
Sequence:CCGGCAGCTTCATCTTCCTGCAACTCTCGAGAGTTGCAGGAAGATGAAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138678.1-278s1c1
Sequence:CCGGGTCAAGACAAAGAGTTGCCCTCTCGAGAGGGCAACTCTTTGTCTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138678.1-709s1c1
Sequence:CCGGGCTGAGAGTCACTTCTCAGTTCTCGAGAACTGAGAAGTGACTCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138678.2-496s21c1
Sequence:CCGGGTGTTTGACAACGGGACTTATCTCGAGATAAGTCCCGTTGTCAAACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138678.2-256s21c1
Sequence:CCGGCACCCACTTCTGGCCATAGTTCTCGAGAACTATGGCCAGAAGTGGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)