EMAIL THIS PAGE TO A FRIEND

BTNL2

butyrophilin-like 2 (MHC class II associated)

55 Gene Product Result for
Synonyms: BTL-II HSBLMHC1 SS2
Gene ID:
Mouse(547431) butyrophilin-like 2
Rat(309620) butyrophilin-like 2 (MHC class II associated)
dog(481730) butyrophilin-like 2 (MHC class II associated)
domestic cat(101081631) butyrophilin-like 2 (MHC class II associated)
cow(789224) butyrophilin-like 2 (MHC class II associated)
Horse(100051881) butyrophilin-like 2 (MHC class II associated)
domestic guinea pig(100736230) butyrophilin-like 2 (MHC class II associated)
sheep(100820745) butyrophilin-like 2 (MHC class II associated)
Domestic Rabbit(100348151) butyrophilin-like 2 (MHC class II associated)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019602 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019602 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019602 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU211071 MISSION® esiRNA esiRNA targeting mouse Btnl2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019602 Rosetta Predictions human pricing
XM_001077327 Rosetta Predictions rat pricing
XM_228004 Rosetta Predictions rat pricing
NM_079835 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019602 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179995 predicted 776
2 SASI_Hs01_00179996 predicted 855
3 SASI_Hs02_00352805 predicted 962
4 SASI_Hs02_00352806 predicted 294
5 SASI_Hs02_00352807 predicted 896
6 SASI_Hs01_00179997 predicted 1120
7 SASI_Hs01_00179999 predicted 558
8 SASI_Hs01_00180000 predicted 353
9 SASI_Hs01_00180001 predicted 265
10 SASI_Hs01_00180002 predicted 923
11 SASI_Hs01_00179998 predicted 324
12 SASI_Hs01_00180003 predicted 634
13 SASI_Hs01_00180004 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077327 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00356658 predicted 1123
2 SASI_Rn02_00356659 predicted 781
3 SASI_Rn02_00356660 predicted 382
4 SASI_Rn02_00356661 predicted 606
5 SASI_Rn02_00356662 predicted 848
6 SASI_Rn02_00356663 predicted 366
7 SASI_Rn02_00356664 predicted 1188
8 SASI_Rn02_00356665 predicted 778
9 SASI_Rn02_00356666 predicted 1257
10 SASI_Rn02_00356667 predicted 775
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228004 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384821 predicted 1119
2 SASI_Rn02_00384822 predicted 789
3 SASI_Rn02_00384823 predicted 378
4 SASI_Rn02_00384824 predicted 608
5 SASI_Rn02_00384825 predicted 853
6 SASI_Rn02_00384826 predicted 369
7 SASI_Rn02_00384827 predicted 1194
8 SASI_Rn02_00384828 predicted 779
9 SASI_Rn02_00384829 predicted 1256
10 SASI_Rn02_00384830 predicted 771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_079835 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047480 predicted 1038
2 SASI_Mm01_00047481 predicted 457
3 SASI_Mm01_00047482 predicted 1444
4 SASI_Mm01_00047483 predicted 344
5 SASI_Mm01_00047484 predicted 1029
6 SASI_Mm01_00047485 predicted 326
7 SASI_Mm02_00338078 predicted 632
8 SASI_Mm01_00047487 predicted 251
9 SASI_Mm01_00047488 predicted 1227
10 SASI_Mm01_00047489 predicted 1106
11 SASI_Mm01_00047486 predicted 1672
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019602
BTNL2 MISSION shRNA Bacterial Glycerol Stock
butyrophilin-like 2 (MHC class II associated)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019602.1-382s1c1
Sequence:CCGGGATGGGAACTACTGTGGAGAACTCGAGTTCTCCACAGTAGTTCCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019602.1-286s1c1
Sequence:CCGGGAGTGGATAGAGAATGGCATTCTCGAGAATGCCATTCTCTATCCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019602.1-400s1c1
Sequence:CCGGGAAACAAGCTTGCTGCTCAAACTCGAGTTTGAGCAGCAAGCTTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019602.1-75s1c1
Sequence:CCGGGTCAGAAGACTTTAGAGTCATCTCGAGATGACTCTAAAGTCTTCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019602.1-1058s1c1
Sequence:CCGGGTTTGGATCTGAAGGTGGTAACTCGAGTTACCACCTTCAGATCCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019602.1-48s1c1
Sequence:CCGGCCTATTCATCCTGCTGACAATCTCGAGATTGTCAGCAGGATGAATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019602.1-350s1c1
Sequence:CCGGCCGACAATGGACAATACTGGTCTCGAGACCAGTATTGTCCATTGTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019602
BTNL2 MISSION shRNA shRNA Plasmid DNA
butyrophilin-like 2 (MHC class II associated)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019602.1-382s1c1
Sequence:CCGGGATGGGAACTACTGTGGAGAACTCGAGTTCTCCACAGTAGTTCCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019602.1-286s1c1
Sequence:CCGGGAGTGGATAGAGAATGGCATTCTCGAGAATGCCATTCTCTATCCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019602.1-400s1c1
Sequence:CCGGGAAACAAGCTTGCTGCTCAAACTCGAGTTTGAGCAGCAAGCTTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019602.1-75s1c1
Sequence:CCGGGTCAGAAGACTTTAGAGTCATCTCGAGATGACTCTAAAGTCTTCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019602.1-1058s1c1
Sequence:CCGGGTTTGGATCTGAAGGTGGTAACTCGAGTTACCACCTTCAGATCCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019602.1-48s1c1
Sequence:CCGGCCTATTCATCCTGCTGACAATCTCGAGATTGTCAGCAGGATGAATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019602.1-350s1c1
Sequence:CCGGCCGACAATGGACAATACTGGTCTCGAGACCAGTATTGTCCATTGTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019602
BTNL2 MISSION shRNA Lentiviral Transduction Particles
butyrophilin-like 2 (MHC class II associated)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019602.1-382s1c1
Sequence:CCGGGATGGGAACTACTGTGGAGAACTCGAGTTCTCCACAGTAGTTCCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019602.1-286s1c1
Sequence:CCGGGAGTGGATAGAGAATGGCATTCTCGAGAATGCCATTCTCTATCCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019602.1-400s1c1
Sequence:CCGGGAAACAAGCTTGCTGCTCAAACTCGAGTTTGAGCAGCAAGCTTGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019602.1-75s1c1
Sequence:CCGGGTCAGAAGACTTTAGAGTCATCTCGAGATGACTCTAAAGTCTTCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019602.1-1058s1c1
Sequence:CCGGGTTTGGATCTGAAGGTGGTAACTCGAGTTACCACCTTCAGATCCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019602.1-48s1c1
Sequence:CCGGCCTATTCATCCTGCTGACAATCTCGAGATTGTCAGCAGGATGAATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019602.1-350s1c1
Sequence:CCGGCCGACAATGGACAATACTGGTCTCGAGACCAGTATTGTCCATTGTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)