EMAIL THIS PAGE TO A FRIEND

BTNL3

butyrophilin-like 3

121 Gene Product Result for
Synonyms: BTNLR
Species: Human BTNL3(10917), Rat Btnl3(407781), domestic guinea pig Btnl3(101788466)
UniProtKB ID: Q6UXE8, Q496L7, Q9Y2C7
Gene ID:
Rat(407781) butyrophilin-like 3
domestic guinea pig(101788466) butyrophilin-like 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006707 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006707 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006707 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU144151 MISSION® esiRNA esiRNA human BTNL3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006707 Rosetta Predictions human pricing
NM_197975 Rosetta Predictions human pricing
NM_001002803 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006707 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196070 predicted 370
2 SASI_Hs01_00196071 predicted 1281
3 SASI_Hs01_00196072 predicted 1303
4 SASI_Hs01_00196073 predicted 1464
5 SASI_Hs01_00196074 predicted 1172
6 SASI_Hs01_00196075 predicted 1334
7 SASI_Hs01_00196076 predicted 207
8 SASI_Hs01_00196077 predicted 1089
9 SASI_Hs01_00196078 predicted 1166
10 SASI_Hs01_00196079 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197975 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099403 predicted 1406
2 SASI_Hs02_00371586 predicted 762
3 SASI_Hs02_00371587 predicted 657
4 SASI_Hs02_00371588 predicted 641
5 SASI_Hs02_00371589 predicted 574
6 SASI_Hs02_00371590 predicted 538
7 SASI_Hs01_00099405 predicted 1270
8 SASI_Hs01_00099406 predicted 1428
9 SASI_Hs01_00099407 predicted 192
10 SASI_Hs02_00371591 predicted 554
11 SASI_Hs01_00099401 predicted 374
12 SASI_Hs01_00099402 predicted 1380
13 SASI_Hs01_00099404 predicted 1567
14 SASI_Hs01_00099408 predicted 1196
15 SASI_Hs01_00099409 predicted 1274
16 SASI_Hs01_00099410 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002803 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060952 predicted 362
2 SASI_Rn01_00060953 predicted 410
3 SASI_Rn01_00060954 predicted 283
4 SASI_Rn02_00197984 predicted 357
5 SASI_Rn01_00060955 predicted 867
6 SASI_Rn01_00060956 predicted 223
7 SASI_Rn01_00060958 predicted 700
8 SASI_Rn01_00060959 predicted 548
9 SASI_Rn02_00197985 predicted 765
10 SASI_Rn02_00197986 predicted 249
11 SASI_Rn01_00060957 predicted 351
12 SASI_Rn01_00060960 predicted 677
13 SASI_Rn01_00060961 predicted 839
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006707
BTNL3 MISSION shRNA Bacterial Glycerol Stock
butyrophilin-like 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006707.2-287s1c1
Sequence:CCGGGCGGTTCTTCAGGAATCAGTTCTCGAGAACTGATTCCTGAAGAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006707.2-413s1c1
Sequence:CCGGGCGTGTCTCTCTAAGGCTAAACTCGAGTTTAGCCTTAGAGAGACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006707.2-1166s1c1
Sequence:CCGGCAGACTGACAACAGAACATTTCTCGAGAAATGTTCTGTTGTCAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006707.2-469s1c1
Sequence:CCGGGCTGGTTCAGTTCCCAGATTTCTCGAGAAATCTGGGAACTGAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006707.2-1338s1c1
Sequence:CCGGGAAGGCTTGTTGAGACCCTATCTCGAGATAGGGTCTCAACAAGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006707
BTNL3 MISSION shRNA shRNA Plasmid DNA
butyrophilin-like 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006707.2-287s1c1
Sequence:CCGGGCGGTTCTTCAGGAATCAGTTCTCGAGAACTGATTCCTGAAGAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006707.2-413s1c1
Sequence:CCGGGCGTGTCTCTCTAAGGCTAAACTCGAGTTTAGCCTTAGAGAGACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006707.2-1166s1c1
Sequence:CCGGCAGACTGACAACAGAACATTTCTCGAGAAATGTTCTGTTGTCAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006707.2-469s1c1
Sequence:CCGGGCTGGTTCAGTTCCCAGATTTCTCGAGAAATCTGGGAACTGAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006707.2-1338s1c1
Sequence:CCGGGAAGGCTTGTTGAGACCCTATCTCGAGATAGGGTCTCAACAAGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006707
BTNL3 MISSION shRNA Lentiviral Transduction Particles
butyrophilin-like 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006707.2-287s1c1
Sequence:CCGGGCGGTTCTTCAGGAATCAGTTCTCGAGAACTGATTCCTGAAGAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006707.2-413s1c1
Sequence:CCGGGCGTGTCTCTCTAAGGCTAAACTCGAGTTTAGCCTTAGAGAGACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006707.2-1166s1c1
Sequence:CCGGCAGACTGACAACAGAACATTTCTCGAGAAATGTTCTGTTGTCAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006707.2-469s1c1
Sequence:CCGGGCTGGTTCAGTTCCCAGATTTCTCGAGAAATCTGGGAACTGAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006707.2-1338s1c1
Sequence:CCGGGAAGGCTTGTTGAGACCCTATCTCGAGATAGGGTCTCAACAAGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks