EMAIL THIS PAGE TO A FRIEND

BTNL8

butyrophilin-like 8

76 Gene Product Result for
Gene ID:
Rat(406160) butyrophilin-like 8
naked mole-rat(101729926) butyrophilin-like 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024850 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024850 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024850 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU126931 MISSION® esiRNA esiRNA human BTNL8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040462 Rosetta Predictions human pricing
NM_024850 Rosetta Predictions human pricing
NM_212489 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040462 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088854 predicted 1503
2 SASI_Hs01_00088856 predicted 1488
3 SASI_Hs01_00088857 predicted 503
4 SASI_Hs01_00088858 predicted 416
5 SASI_Hs01_00088859 predicted 516
6 SASI_Hs01_00088860 predicted 1285
7 SASI_Hs01_00088861 predicted 1443
8 SASI_Hs01_00088862 predicted 314
9 SASI_Hs01_00088863 predicted 1574
10 SASI_Hs02_00309003 predicted 1431
11 SASI_Hs01_00088855 predicted 1499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024850 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078262 predicted 1603
2 SASI_Hs01_00078264 predicted 1586
3 SASI_Hs01_00078265 predicted 480
4 SASI_Hs01_00078266 predicted 383
5 SASI_Hs01_00078267 predicted 493
6 SASI_Hs01_00078268 predicted 1382
7 SASI_Hs01_00078269 predicted 1540
8 SASI_Hs01_00078270 predicted 284
9 SASI_Hs01_00078271 predicted 1675
10 SASI_Hs02_00357427 predicted 1532
11 SASI_Hs01_00078263 predicted 1597
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212489 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079977 predicted 549
2 SASI_Rn01_00079978 predicted 551
3 SASI_Rn01_00079981 predicted 1867
4 SASI_Rn01_00079979 predicted 606
5 SASI_Rn01_00079980 predicted 867
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024850
BTNL8 MISSION shRNA Bacterial Glycerol Stock
butyrophilin-like 8
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024850.2-782s21c1
Sequence:CCGGGAGACATGCATGGCCTGTTTGCTCGAGCAAACAGGCCATGCATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024850.2-1694s21c1
Sequence:CCGGATTGAGTATCCGTCCTATAATCTCGAGATTATAGGACGGATACTCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024850.2-1469s21c1
Sequence:CCGGGTGACTTTGTCTCCCGATCATCTCGAGATGATCGGGAGACAAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024850.2-577s21c1
Sequence:CCGGAGGATTAGTTCCCAGTCTTACCTCGAGGTAAGACTGGGAACTAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024850.1-969s1c1
Sequence:CCGGGCCTTATTCATGGTTCCAGCACTCGAGTGCTGGAACCATGAATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024850.1-567s1c1
Sequence:CCGGCTCATTTCCATCACGGGATATCTCGAGATATCCCGTGATGGAAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024850.1-588s1c1
Sequence:CCGGGTTGATAGAGACATCCAGCTACTCGAGTAGCTGGATGTCTCTATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024850.1-923s1c1
Sequence:CCGGCTTCTCCAAATTCCAGTGTAACTCGAGTTACACTGGAATTTGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024850.1-1023s1c1
Sequence:CCGGGCTTCTCTTCTTCTAGTCCTACTCGAGTAGGACTAGAAGAAGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024850.1-858s1c1
Sequence:CCGGGCTACCAAAGTACTGGGAATACTCGAGTATTCCCAGTACTTTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024850.1-1237s1c1
Sequence:CCGGCCTCACTCTGAGAAGAGATTTCTCGAGAAATCTCTTCTCAGAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024850.1-580s1c1
Sequence:CCGGCGGGATATGTTGATAGAGACACTCGAGTGTCTCTATCAACATATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024850
BTNL8 MISSION shRNA shRNA Plasmid DNA
butyrophilin-like 8
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024850.2-782s21c1
Sequence:CCGGGAGACATGCATGGCCTGTTTGCTCGAGCAAACAGGCCATGCATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024850.2-1694s21c1
Sequence:CCGGATTGAGTATCCGTCCTATAATCTCGAGATTATAGGACGGATACTCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024850.2-1469s21c1
Sequence:CCGGGTGACTTTGTCTCCCGATCATCTCGAGATGATCGGGAGACAAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024850.2-577s21c1
Sequence:CCGGAGGATTAGTTCCCAGTCTTACCTCGAGGTAAGACTGGGAACTAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024850.1-969s1c1
Sequence:CCGGGCCTTATTCATGGTTCCAGCACTCGAGTGCTGGAACCATGAATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024850.1-567s1c1
Sequence:CCGGCTCATTTCCATCACGGGATATCTCGAGATATCCCGTGATGGAAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024850.1-588s1c1
Sequence:CCGGGTTGATAGAGACATCCAGCTACTCGAGTAGCTGGATGTCTCTATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024850.1-923s1c1
Sequence:CCGGCTTCTCCAAATTCCAGTGTAACTCGAGTTACACTGGAATTTGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024850.1-1023s1c1
Sequence:CCGGGCTTCTCTTCTTCTAGTCCTACTCGAGTAGGACTAGAAGAAGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024850.1-858s1c1
Sequence:CCGGGCTACCAAAGTACTGGGAATACTCGAGTATTCCCAGTACTTTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024850.1-1237s1c1
Sequence:CCGGCCTCACTCTGAGAAGAGATTTCTCGAGAAATCTCTTCTCAGAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024850.1-580s1c1
Sequence:CCGGCGGGATATGTTGATAGAGACACTCGAGTGTCTCTATCAACATATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024850
BTNL8 MISSION shRNA Lentiviral Transduction Particles
butyrophilin-like 8
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024850.2-782s21c1
Sequence:CCGGGAGACATGCATGGCCTGTTTGCTCGAGCAAACAGGCCATGCATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024850.2-1694s21c1
Sequence:CCGGATTGAGTATCCGTCCTATAATCTCGAGATTATAGGACGGATACTCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024850.2-1469s21c1
Sequence:CCGGGTGACTTTGTCTCCCGATCATCTCGAGATGATCGGGAGACAAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024850.2-577s21c1
Sequence:CCGGAGGATTAGTTCCCAGTCTTACCTCGAGGTAAGACTGGGAACTAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024850.1-969s1c1
Sequence:CCGGGCCTTATTCATGGTTCCAGCACTCGAGTGCTGGAACCATGAATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024850.1-567s1c1
Sequence:CCGGCTCATTTCCATCACGGGATATCTCGAGATATCCCGTGATGGAAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024850.1-588s1c1
Sequence:CCGGGTTGATAGAGACATCCAGCTACTCGAGTAGCTGGATGTCTCTATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024850.1-923s1c1
Sequence:CCGGCTTCTCCAAATTCCAGTGTAACTCGAGTTACACTGGAATTTGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024850.1-1023s1c1
Sequence:CCGGGCTTCTCTTCTTCTAGTCCTACTCGAGTAGGACTAGAAGAAGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024850.1-858s1c1
Sequence:CCGGGCTACCAAAGTACTGGGAATACTCGAGTATTCCCAGTACTTTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024850.1-1237s1c1
Sequence:CCGGCCTCACTCTGAGAAGAGATTTCTCGAGAAATCTCTTCTCAGAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024850.1-580s1c1
Sequence:CCGGCGGGATATGTTGATAGAGACACTCGAGTGTCTCTATCAACATATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks