EMAIL THIS PAGE TO A FRIEND

BTNL9

butyrophilin-like 9

31 Gene Product Result for
Synonyms: BTN3 VDLS1900
UniProtKB ID: Q6UXG8, A6NL42, Q6P660, Q96DM5
Gene ID:
Mouse(237754) butyrophilin-like 9
cow(100125313) butyrophilin-like 9
Horse(100066286) butyrophilin-like 9
dog(491672) butyrophilin-like 9
naked mole-rat(101719411) butyrophilin-like 9
sheep(101105155) butyrophilin-like 9
Domestic Rabbit(100354115) butyrophilin-like 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152547 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152547 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152547 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172793 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172793 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172793 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU062681 MISSION® esiRNA esiRNA human BTNL9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152547 Rosetta Predictions human pricing
NM_172793 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152547 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172093 predicted 587
2 SASI_Hs02_00366351 predicted 836
3 SASI_Hs01_00172095 predicted 758
4 SASI_Hs01_00172096 predicted 527
5 SASI_Hs01_00172097 predicted 330
6 SASI_Hs01_00172098 predicted 1883
7 SASI_Hs01_00172099 predicted 262
8 SASI_Hs01_00172100 predicted 533
9 SASI_Hs01_00172101 predicted 929
10 SASI_Hs01_00172102 predicted 1767
11 SASI_Hs01_00172094 predicted 1955
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172793 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150933 predicted 423
2 SASI_Mm01_00150934 predicted 1589
3 SASI_Mm01_00150936 predicted 1597
4 SASI_Mm01_00150937 predicted 501
5 SASI_Mm01_00150938 predicted 784
6 SASI_Mm01_00150939 predicted 425
7 SASI_Mm01_00150940 predicted 445
8 SASI_Mm02_00344699 predicted 784
9 SASI_Mm01_00150941 predicted 1144
10 SASI_Mm01_00150942 predicted 1664
11 SASI_Mm01_00150935 predicted 1496
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152547
BTNL9 MISSION shRNA Bacterial Glycerol Stock
butyrophilin-like 9
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152547.1-806s1c1
Sequence:CCGGCAGAGTTTGAAGCCATCGTCTCTCGAGAGACGATGGCTTCAAACTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152547.1-840s1c1
Sequence:CCGGCCTGTTCAGTCTGGAAACATCCTCGAGGATGTTTCCAGACTGAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151082    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152547.2-3072s1c1
Sequence:CCGGGCTATGTAGGAGAACATTCTTCTCGAGAAGAATGTTCTCCTACATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151522    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152547.2-3258s1c1
Sequence:CCGGCGACAGATGTTCATTGTACTACTCGAGTAGTACAATGAACATCTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152547.2-3144s1c1
Sequence:CCGGCCACTGAATTTCCAGTGACTACTCGAGTAGTCACTGGAAATTCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153292    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152547.2-2362s1c1
Sequence:CCGGGCATTGTGTGTGGTGAAGTAACTCGAGTTACTTCACCACACACAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152547.1-522s1c1
Sequence:CCGGGAACAGGACCAAGTTGGTCAACTCGAGTTGACCAACTTGGTCCTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152547.1-447s1c1
Sequence:CCGGGAGTCAGACCTTCAATGTGGTCTCGAGACCACATTGAAGGTCTGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152547.1-270s1c1
Sequence:CCGGCAGCAGTCTTGTCTTCCTCATCTCGAGATGAGGAAGACAAGACTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155077    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152547.1-853s1c1
Sequence:CCGGGAAACATCTGTGGTTGTCCGACTCGAGTCGGACAACCACAGATGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152547.1-921s1c1
Sequence:CCGGGAGCCAGAAGAAAGAGTTGGTCTCGAGACCAACTCTTTCTTCTGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152547.1-455s1c1
Sequence:CCGGCCTTCAATGTGGTACACCTGTCTCGAGACAGGTGTACCACATTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152547
BTNL9 MISSION shRNA shRNA Plasmid DNA
butyrophilin-like 9
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152547.1-806s1c1
Sequence:CCGGCAGAGTTTGAAGCCATCGTCTCTCGAGAGACGATGGCTTCAAACTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152547.1-840s1c1
Sequence:CCGGCCTGTTCAGTCTGGAAACATCCTCGAGGATGTTTCCAGACTGAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151082    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152547.2-3072s1c1
Sequence:CCGGGCTATGTAGGAGAACATTCTTCTCGAGAAGAATGTTCTCCTACATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151522    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152547.2-3258s1c1
Sequence:CCGGCGACAGATGTTCATTGTACTACTCGAGTAGTACAATGAACATCTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152547.2-3144s1c1
Sequence:CCGGCCACTGAATTTCCAGTGACTACTCGAGTAGTCACTGGAAATTCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153292    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152547.2-2362s1c1
Sequence:CCGGGCATTGTGTGTGGTGAAGTAACTCGAGTTACTTCACCACACACAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152547.1-522s1c1
Sequence:CCGGGAACAGGACCAAGTTGGTCAACTCGAGTTGACCAACTTGGTCCTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152547.1-447s1c1
Sequence:CCGGGAGTCAGACCTTCAATGTGGTCTCGAGACCACATTGAAGGTCTGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152547.1-270s1c1
Sequence:CCGGCAGCAGTCTTGTCTTCCTCATCTCGAGATGAGGAAGACAAGACTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155077    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152547.1-853s1c1
Sequence:CCGGGAAACATCTGTGGTTGTCCGACTCGAGTCGGACAACCACAGATGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152547.1-921s1c1
Sequence:CCGGGAGCCAGAAGAAAGAGTTGGTCTCGAGACCAACTCTTTCTTCTGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152547.1-455s1c1
Sequence:CCGGCCTTCAATGTGGTACACCTGTCTCGAGACAGGTGTACCACATTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152547
BTNL9 MISSION shRNA Lentiviral Transduction Particles
butyrophilin-like 9
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152547.1-806s1c1
Sequence:CCGGCAGAGTTTGAAGCCATCGTCTCTCGAGAGACGATGGCTTCAAACTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152547.1-840s1c1
Sequence:CCGGCCTGTTCAGTCTGGAAACATCCTCGAGGATGTTTCCAGACTGAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151082    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152547.2-3072s1c1
Sequence:CCGGGCTATGTAGGAGAACATTCTTCTCGAGAAGAATGTTCTCCTACATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151522    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152547.2-3258s1c1
Sequence:CCGGCGACAGATGTTCATTGTACTACTCGAGTAGTACAATGAACATCTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152547.2-3144s1c1
Sequence:CCGGCCACTGAATTTCCAGTGACTACTCGAGTAGTCACTGGAAATTCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153292    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152547.2-2362s1c1
Sequence:CCGGGCATTGTGTGTGGTGAAGTAACTCGAGTTACTTCACCACACACAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152547.1-522s1c1
Sequence:CCGGGAACAGGACCAAGTTGGTCAACTCGAGTTGACCAACTTGGTCCTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152547.1-447s1c1
Sequence:CCGGGAGTCAGACCTTCAATGTGGTCTCGAGACCACATTGAAGGTCTGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152547.1-270s1c1
Sequence:CCGGCAGCAGTCTTGTCTTCCTCATCTCGAGATGAGGAAGACAAGACTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155077    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152547.1-853s1c1
Sequence:CCGGGAAACATCTGTGGTTGTCCGACTCGAGTCGGACAACCACAGATGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152547.1-921s1c1
Sequence:CCGGGAGCCAGAAGAAAGAGTTGGTCTCGAGACCAACTCTTTCTTCTGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152547.1-455s1c1
Sequence:CCGGCCTTCAATGTGGTACACCTGTCTCGAGACAGGTGTACCACATTGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172793
BTNL9 MISSION shRNA Bacterial Glycerol Stock
butyrophilin-like 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115561    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172793.1-1834s1c1
Sequence:CCGGGCCTATACAGATGAATGTATACTCGAGTATACATTCATCTGTATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172793.1-523s1c1
Sequence:CCGGCCGCTTTCTTTCTGACAACTTCTCGAGAAGTTGTCAGAAAGAAAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172793.1-421s1c1
Sequence:CCGGGTTCCGAAACAGGACCTTATTCTCGAGAATAAGGTCCTGTTTCGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172793.1-470s1c1
Sequence:CCGGGTGAACCTACACATCCTTAAACTCGAGTTTAAGGATGTGTAGGTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172793.1-788s1c1
Sequence:CCGGCATAGCAATGTGTCTTGTATACTCGAGTATACAAGACACATTGCTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172793
BTNL9 MISSION shRNA shRNA Plasmid DNA
butyrophilin-like 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115561    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172793.1-1834s1c1
Sequence:CCGGGCCTATACAGATGAATGTATACTCGAGTATACATTCATCTGTATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172793.1-523s1c1
Sequence:CCGGCCGCTTTCTTTCTGACAACTTCTCGAGAAGTTGTCAGAAAGAAAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172793.1-421s1c1
Sequence:CCGGGTTCCGAAACAGGACCTTATTCTCGAGAATAAGGTCCTGTTTCGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172793.1-470s1c1
Sequence:CCGGGTGAACCTACACATCCTTAAACTCGAGTTTAAGGATGTGTAGGTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172793.1-788s1c1
Sequence:CCGGCATAGCAATGTGTCTTGTATACTCGAGTATACAAGACACATTGCTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172793
BTNL9 MISSION shRNA Lentiviral Transduction Particles
butyrophilin-like 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115561    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172793.1-1834s1c1
Sequence:CCGGGCCTATACAGATGAATGTATACTCGAGTATACATTCATCTGTATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172793.1-523s1c1
Sequence:CCGGCCGCTTTCTTTCTGACAACTTCTCGAGAAGTTGTCAGAAAGAAAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172793.1-421s1c1
Sequence:CCGGGTTCCGAAACAGGACCTTATTCTCGAGAATAAGGTCCTGTTTCGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172793.1-470s1c1
Sequence:CCGGGTGAACCTACACATCCTTAAACTCGAGTTTAAGGATGTGTAGGTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172793.1-788s1c1
Sequence:CCGGCATAGCAATGTGTCTTGTATACTCGAGTATACAAGACACATTGCTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)