EMAIL THIS PAGE TO A FRIEND

BTRC

beta-transducin repeat containing E3 ubiquitin protein ligase

178 Gene Product Result for
Synonyms: BETA-TRCP FBW1A FBXW1 FBXW1A FWD1 bTrCP bTrCP1 betaTrCP
UniProtKB ID: Q9Y297, B5MD49, Q5W141, Q5W142, Q9Y213
Gene ID:
Human(8945) Summary: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbws class; in addition to an F-box, this protein contains multiple WD-40 repeats. The encoded protein mediates degradation of CD4 via its interaction with HIV-1 Vpu. It has also been shown to ubiquitinate phosphorylated NFKBIA (nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha), targeting it for degradation and thus activating nuclear factor kappa-B. Alternatively spliced transcript variants have been described. A related pseudogene exists in chromosome 6. [provided by RefSeq, Mar 2012]
Mouse(12234) beta-transducin repeat containing protein
Rat(361765) beta-transducin repeat containing E3 ubiquitin protein ligase
chicken(423854) beta-transducin repeat containing
dog(486851) beta-transducin repeat containing E3 ubiquitin protein ligase
cow(534072) beta-transducin repeat containing
domestic cat(101097596) beta-transducin repeat containing E3 ubiquitin protein ligase
Horse(100070200) beta-transducin repeat containing E3 ubiquitin protein ligase
sheep(101101939) beta-transducin repeat containing E3 ubiquitin protein ligase
Domestic Rabbit(100350519) beta-transducin repeat containing E3 ubiquitin protein ligase
naked mole-rat(101726740) beta-transducin repeat containing E3 ubiquitin protein ligase
domestic guinea pig(100730107) beta-transducin repeat containing E3 ubiquitin protein ligase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003939 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003939 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003939 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009771 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009771 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009771 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU069931 MISSION® esiRNA esiRNA human BTRC (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003939 Rosetta Predictions human pricing
NM_033637 Rosetta Predictions human pricing
NM_001007148 Rosetta Predictions rat pricing
NM_001037758 Rosetta Predictions mouse pricing
NM_009771 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003939 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189438 predicted 1155
2 SASI_Hs01_00189439 predicted 1357
3 SASI_Hs01_00189440 predicted 1855
4 SASI_Hs02_00336590 predicted 1450
5 SASI_Hs01_00189446 predicted 879
6 SASI_Hs01_00189447 predicted 494
7 SASI_Hs02_00336591 predicted 993
8 SASI_Hs02_00336592 predicted 1204
9 SASI_Hs02_00336593 predicted 586
10 SASI_Hs02_00336594 predicted 414
11 SASI_Hs01_00189441 predicted 585
12 SASI_Hs01_00189442 predicted 1128
13 SASI_Hs01_00189443 predicted 832
14 SASI_Hs01_00189444 predicted 374
15 SASI_Hs01_00189445 predicted 783
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033637 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190307 predicted 1266
2 SASI_Hs01_00190308 predicted 1457
3 SASI_Hs01_00190309 predicted 1958
4 SASI_Hs02_00361448 predicted 1554
5 SASI_Hs01_00190315 predicted 988
6 SASI_Hs01_00190316 predicted 603
7 SASI_Hs02_00361449 predicted 1101
8 SASI_Hs02_00361450 predicted 1318
9 SASI_Hs02_00361451 predicted 694
10 SASI_Hs02_00361452 predicted 514
11 SASI_Hs01_00190310 predicted 689
12 SASI_Hs01_00190311 predicted 1228
13 SASI_Hs01_00190312 predicted 942
14 SASI_Hs01_00190313 predicted 480
15 SASI_Hs01_00190314 predicted 897
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007148 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085325 predicted 568
2 SASI_Rn01_00085326 predicted 1663
3 SASI_Rn01_00085327 predicted 2018
4 SASI_Rn01_00085328 predicted 1930
5 SASI_Rn01_00085329 predicted 593
6 SASI_Rn02_00198625 predicted 298
7 SASI_Rn02_00198626 predicted 359
8 SASI_Rn01_00085331 predicted 1982
9 SASI_Rn01_00085332 predicted 1485
10 SASI_Rn01_00085333 predicted 972
11 SASI_Rn01_00085330 predicted 550
12 SASI_Rn01_00085334 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037758 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289417 predicted 1950
2 SASI_Mm01_00051570 predicted 1234
3 SASI_Mm02_00289418 predicted 1898
4 SASI_Mm01_00051572 predicted 1656
5 SASI_Mm02_00289419 predicted 566
6 SASI_Mm02_00289420 predicted 538
7 SASI_Mm02_00289421 predicted 470
8 SASI_Mm02_00289422 predicted 1955
9 SASI_Mm02_00289423 predicted 1800
10 SASI_Mm02_00289424 predicted 1162
11 SASI_Mm01_00051569 predicted 1245
12 SASI_Mm01_00051571 predicted 1619
13 SASI_Mm01_00051573 predicted 1185
14 SASI_Mm01_00051574 predicted 1564
15 SASI_Mm01_00051575 predicted 1571
16 SASI_Mm01_00051576 predicted 1724
17 SASI_Mm01_00051577 predicted 1608
18 SASI_Mm01_00051578 predicted 1460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009771 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316979 predicted 1848
2 SASI_Mm01_00127874 predicted 1118
3 SASI_Mm02_00316980 predicted 1794
4 SASI_Mm01_00127876 predicted 1550
5 SASI_Mm02_00316981 predicted 460
6 SASI_Mm02_00316982 predicted 426
7 SASI_Mm02_00316983 predicted 360
8 SASI_Mm02_00316984 predicted 1842
9 SASI_Mm02_00316985 predicted 1695
10 SASI_Mm02_00316986 predicted 1059
11 SASI_Mm01_00127873 predicted 1131
12 SASI_Mm01_00127875 predicted 1510
13 SASI_Mm01_00127877 predicted 1082
14 SASI_Mm01_00127878 predicted 1451
15 SASI_Mm01_00127879 predicted 1474
16 SASI_Mm01_00127880 predicted 1613
17 SASI_Mm01_00127881 predicted 1500
18 SASI_Mm01_00127882 predicted 1349
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003939
VALIDATED
BTRC MISSION shRNA Bacterial Glycerol Stock
beta-transducin repeat containing E3 ubiquitin protein ligase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006541    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_003939.2-1858s1c1
Sequence:CCGGCCATTAAAGTTGCGGTATTTACTCGAGTAAATACCGCAACTTTAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003939.2-503s1c1
Sequence:CCGGGCACATAAACTCGTATCTTAACTCGAGTTAAGATACGAGTTTATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003939.2-1532s1c1
Sequence:CCGGGCGTTGTATTCGATTTGATAACTCGAGTTATCAAATCGAATACAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003939.2-1172s1c1
Sequence:CCGGGCGTTTCAATAATGGCATGATCTCGAGATCATGCCATTATTGAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003939.2-627s1c1
Sequence:CCGGGCTGAACTTGTGTGCAAGGAACTCGAGTTCCTTGCACACAAGTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_003939.3-627s21c1
Sequence:CCGGGCTGAACTTGTGTGCAAGGAACTCGAGTTCCTTGCACACAAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_003939.3-1532s21c1
Sequence:CCGGGCGTTGTATTCGATTTGATAACTCGAGTTATCAAATCGAATACAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003939.3-491s21c1
Sequence:CCGGTTACCAACATGGGCACATAAACTCGAGTTTATGTGCCCATGTTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314900    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003939.3-1845s21c1
Sequence:CCGGACTTGCCCAGGACCCATTAAACTCGAGTTTAATGGGTCCTGGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_003939.3-864s21c1
Sequence:CCGGAGATGTGGAAGACATAGTTTACTCGAGTAAACTATGTCTTCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003939
VALIDATED
BTRC MISSION shRNA shRNA Plasmid DNA
beta-transducin repeat containing E3 ubiquitin protein ligase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006541    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_003939.2-1858s1c1
Sequence:CCGGCCATTAAAGTTGCGGTATTTACTCGAGTAAATACCGCAACTTTAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003939.2-503s1c1
Sequence:CCGGGCACATAAACTCGTATCTTAACTCGAGTTAAGATACGAGTTTATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003939.2-1532s1c1
Sequence:CCGGGCGTTGTATTCGATTTGATAACTCGAGTTATCAAATCGAATACAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003939.2-1172s1c1
Sequence:CCGGGCGTTTCAATAATGGCATGATCTCGAGATCATGCCATTATTGAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003939.2-627s1c1
Sequence:CCGGGCTGAACTTGTGTGCAAGGAACTCGAGTTCCTTGCACACAAGTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_003939.3-627s21c1
Sequence:CCGGGCTGAACTTGTGTGCAAGGAACTCGAGTTCCTTGCACACAAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_003939.3-1532s21c1
Sequence:CCGGGCGTTGTATTCGATTTGATAACTCGAGTTATCAAATCGAATACAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003939.3-491s21c1
Sequence:CCGGTTACCAACATGGGCACATAAACTCGAGTTTATGTGCCCATGTTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314900    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003939.3-1845s21c1
Sequence:CCGGACTTGCCCAGGACCCATTAAACTCGAGTTTAATGGGTCCTGGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_003939.3-864s21c1
Sequence:CCGGAGATGTGGAAGACATAGTTTACTCGAGTAAACTATGTCTTCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003939
VALIDATED
BTRC MISSION shRNA Lentiviral Transduction Particles
beta-transducin repeat containing E3 ubiquitin protein ligase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006541    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_003939.2-1858s1c1
Sequence:CCGGCCATTAAAGTTGCGGTATTTACTCGAGTAAATACCGCAACTTTAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003939.2-503s1c1
Sequence:CCGGGCACATAAACTCGTATCTTAACTCGAGTTAAGATACGAGTTTATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003939.2-1532s1c1
Sequence:CCGGGCGTTGTATTCGATTTGATAACTCGAGTTATCAAATCGAATACAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003939.2-1172s1c1
Sequence:CCGGGCGTTTCAATAATGGCATGATCTCGAGATCATGCCATTATTGAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003939.2-627s1c1
Sequence:CCGGGCTGAACTTGTGTGCAAGGAACTCGAGTTCCTTGCACACAAGTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_003939.3-627s21c1
Sequence:CCGGGCTGAACTTGTGTGCAAGGAACTCGAGTTCCTTGCACACAAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_003939.3-1532s21c1
Sequence:CCGGGCGTTGTATTCGATTTGATAACTCGAGTTATCAAATCGAATACAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003939.3-491s21c1
Sequence:CCGGTTACCAACATGGGCACATAAACTCGAGTTTATGTGCCCATGTTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314900    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003939.3-1845s21c1
Sequence:CCGGACTTGCCCAGGACCCATTAAACTCGAGTTTAATGGGTCCTGGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_003939.3-864s21c1
Sequence:CCGGAGATGTGGAAGACATAGTTTACTCGAGTAAACTATGTCTTCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009771
VALIDATED
BTRC MISSION shRNA Bacterial Glycerol Stock
beta-transducin repeat containing E3 ubiquitin protein ligase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009771.1-1815s1c1
Sequence:CCGGGCCTCATAATTGCCCAGGATTCTCGAGAATCCTGGGCAATTATGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009771.1-232s1c1
Sequence:CCGGGCCAGGCTTTGCATAAACCAACTCGAGTTGGTTTATGCAAAGCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009771.1-849s1c1
Sequence:CCGGGCGACATAGTTTACAGAGAATCTCGAGATTCTCTGTAAACTATGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009771.1-1074s1c1
Sequence:CCGGCGTCAGAGTGTGGGATGTAAACTCGAGTTTACATCCCACACTCTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009771.1-1659s1c1
Sequence:CCGGCCGCCTCCAGTTTGATGAATTCTCGAGAATTCATCAAACTGGAGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009771.3-1520s21c1
Sequence:CCGGTGGTACGCTGCATTCGATTTGCTCGAGCAAATCGAATGCAGCGTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009771.3-834s21c1
Sequence:CCGGTGAGACAATAGAGTCCAATTGCTCGAGCAATTGGACTCTATTGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009771.3-495s21c1
Sequence:CCGGGCACATCAACTCCTACCTAAACTCGAGTTTAGGTAGGAGTTGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009771.3-448s21c1
Sequence:CCGGGAATTTGTAGAACACCTTATACTCGAGTATAAGGTGTTCTACAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009771
VALIDATED
BTRC MISSION shRNA shRNA Plasmid DNA
beta-transducin repeat containing E3 ubiquitin protein ligase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009771.1-1815s1c1
Sequence:CCGGGCCTCATAATTGCCCAGGATTCTCGAGAATCCTGGGCAATTATGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009771.1-232s1c1
Sequence:CCGGGCCAGGCTTTGCATAAACCAACTCGAGTTGGTTTATGCAAAGCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009771.1-849s1c1
Sequence:CCGGGCGACATAGTTTACAGAGAATCTCGAGATTCTCTGTAAACTATGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009771.1-1074s1c1
Sequence:CCGGCGTCAGAGTGTGGGATGTAAACTCGAGTTTACATCCCACACTCTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009771.1-1659s1c1
Sequence:CCGGCCGCCTCCAGTTTGATGAATTCTCGAGAATTCATCAAACTGGAGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009771.3-1520s21c1
Sequence:CCGGTGGTACGCTGCATTCGATTTGCTCGAGCAAATCGAATGCAGCGTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009771.3-834s21c1
Sequence:CCGGTGAGACAATAGAGTCCAATTGCTCGAGCAATTGGACTCTATTGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009771.3-495s21c1
Sequence:CCGGGCACATCAACTCCTACCTAAACTCGAGTTTAGGTAGGAGTTGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009771.3-448s21c1
Sequence:CCGGGAATTTGTAGAACACCTTATACTCGAGTATAAGGTGTTCTACAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009771
VALIDATED
BTRC MISSION shRNA Lentiviral Transduction Particles
beta-transducin repeat containing E3 ubiquitin protein ligase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009771.1-1815s1c1
Sequence:CCGGGCCTCATAATTGCCCAGGATTCTCGAGAATCCTGGGCAATTATGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009771.1-232s1c1
Sequence:CCGGGCCAGGCTTTGCATAAACCAACTCGAGTTGGTTTATGCAAAGCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009771.1-849s1c1
Sequence:CCGGGCGACATAGTTTACAGAGAATCTCGAGATTCTCTGTAAACTATGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009771.1-1074s1c1
Sequence:CCGGCGTCAGAGTGTGGGATGTAAACTCGAGTTTACATCCCACACTCTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009771.1-1659s1c1
Sequence:CCGGCCGCCTCCAGTTTGATGAATTCTCGAGAATTCATCAAACTGGAGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009771.3-1520s21c1
Sequence:CCGGTGGTACGCTGCATTCGATTTGCTCGAGCAAATCGAATGCAGCGTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009771.3-834s21c1
Sequence:CCGGTGAGACAATAGAGTCCAATTGCTCGAGCAATTGGACTCTATTGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009771.3-495s21c1
Sequence:CCGGGCACATCAACTCCTACCTAAACTCGAGTTTAGGTAGGAGTTGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009771.3-448s21c1
Sequence:CCGGGAATTTGTAGAACACCTTATACTCGAGTATAAGGTGTTCTACAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks