EMAIL THIS PAGE TO A FRIEND

BUB1

BUB1 mitotic checkpoint serine/threonine kinase

118 Gene Product Result for
Synonyms: BUB1A BUB1L hBUB1
UniProtKB ID: O43683, O43430, O43643, O60626, Q53QE4
Gene ID:
Human(699) Summary: This gene encodes a serine/threonine-protein kinase that play a central role in mitosis. The encoded protein functions in part by phosphorylating members of the mitotic checkpoint complex and activating the spindle checkpoint. This protein also plays a role in inhibiting the activation of the anaphase promoting complex/cyclosome. This protein may also function in the DNA damage response. Mutations in this gene have been associated with aneuploidy and several forms of cancer. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Mouse(12235) budding uninhibited by benzimidazoles 1 homolog (S. cerevisiae)
Rat(296137) BUB1 mitotic checkpoint serine/threonine kinase
Zebrafish(100307076) BUB1 mitotic checkpoint serine/threonine kinase
fruit fly(33758) Bub1 homologue
cow(514777) budding uninhibited by benzimidazoles 1 homolog (yeast)
Horse(100064049) budding uninhibited by benzimidazoles 1 homolog (yeast)
domestic cat(101085035) budding uninhibited by benzimidazoles 1 homolog (yeast)
dog(100682599) budding uninhibited by benzimidazoles 1 homolog (yeast)
chicken(421226) budding uninhibited by benzimidazoles 1 homolog (yeast)
naked mole-rat(101724275) BUB1 mitotic checkpoint serine/threonine kinase
domestic guinea pig(100725012) BUB1 mitotic checkpoint serine/threonine kinase
sheep(101117404) budding uninhibited by benzimidazoles 1 homolog (yeast)
Domestic Rabbit(100352234) budding uninhibited by benzimidazoles 1 homolog (yeast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
B3437 Anti-BUB1 (146-160) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
B3562 Anti-BUB1 (536-550) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB3500373 Anti-Bub1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, immunocytochemistry, western blot pricing
HPA006123 Anti-BUB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4502937 Anti-BUB1 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunohistochemistry pricing
SAB1306138 ANTI-BUB1A(N-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
flow cytometry, western blot pricing
B0561 Monoclonal Anti-BUB1 antibody produced in mouse 2 mg/mL, clone 14H5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunocytochemistry, immunoprecipitation, microarray, western blot pricing
WH0000699M1 Monoclonal Anti-BUB1 antibody produced in mouse clone 4C3-4C9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1403620 Monoclonal Anti-BUB1, (N-terminal) antibody produced in mouse clone 2F9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0013 AQUA Peptide GIQNQAEP[R] cow, human pricing
AQ0012 AQUA Peptide LPVESVHILED[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009772 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009772 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009772 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004336 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004336 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004336 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU014831 MISSION® esiRNA esiRNA targeting human BUB1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004336 siRNAs that have been validated in the lab human pricing
NM_001106507 Rosetta Predictions rat pricing
NM_001113179 Rosetta Predictions mouse pricing
NM_009772 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004336 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133600 validated 1368
2 SASI_Hs01_00133601 predicted 1038
3 SASI_Hs01_00133602 predicted 767
4 SASI_Hs02_00337391 predicted 1486
5 SASI_Hs01_00133603 predicted 512
6 SASI_Hs01_00133604 predicted 2616
7 SASI_Hs01_00133605 predicted 2676
8 SASI_Hs01_00133606 predicted 692
9 SASI_Hs02_00337392 predicted 2097
10 SASI_Hs01_00133608 predicted 3028
11 SASI_Hs01_00133599 predicted 2922
12 SASI_Hs01_00133607 predicted 876
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106507 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219648 predicted 1264
2 SASI_Rn02_00219649 predicted 2636
3 SASI_Rn02_00219650 predicted 3087
4 SASI_Rn02_00219651 predicted 3043
5 SASI_Rn02_00219652 predicted 2784
6 SASI_Rn02_00219653 predicted 765
7 SASI_Rn02_00219654 predicted 2206
8 SASI_Rn02_00219655 predicted 2991
9 SASI_Rn02_00219656 predicted 1241
10 SASI_Rn02_00219657 predicted 1918
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113179 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307143 predicted 1972
2 SASI_Mm02_00307144 predicted 385
3 SASI_Mm02_00307145 predicted 2861
4 SASI_Mm02_00307146 predicted 1792
5 SASI_Mm02_00307147 predicted 2650
6 SASI_Mm02_00307148 predicted 491
7 SASI_Mm02_00307149 predicted 232
8 SASI_Mm02_00307150 predicted 2024
9 SASI_Mm02_00307151 predicted 2803
10 SASI_Mm02_00307152 predicted 1727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009772 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316987 predicted 1971
2 SASI_Mm01_00168560 predicted 387
3 SASI_Mm01_00168561 predicted 2856
4 SASI_Mm01_00168563 predicted 1790
5 SASI_Mm01_00168564 predicted 2647
6 SASI_Mm01_00168565 predicted 487
7 SASI_Mm02_00316988 predicted 238
8 SASI_Mm02_00316989 predicted 2016
9 SASI_Mm01_00168568 predicted 2795
10 SASI_Mm02_00316990 predicted 1725
11 SASI_Mm01_00168559 predicted 489
12 SASI_Mm01_00168562 predicted 1344
13 SASI_Mm01_00168566 predicted 538
14 SASI_Mm01_00168567 predicted 618
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009772
VALIDATED
BUB1 MISSION shRNA Bacterial Glycerol Stock
BUB1 mitotic checkpoint serine/threonine kinase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009772.2-502s21c1
Sequence:CCGGGCTGAACCTAAAGAACTACTACTCGAGTAGTAGTTCTTTAGGTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009772.2-1507s21c1
Sequence:CCGGGCTCCAACACTTCCTGACATTCTCGAGAATGTCAGGAAGTGTTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009772.2-2727s21c1
Sequence:CCGGCGCTATCAGAATGCTTTACATCTCGAGATGTAAAGCATTCTGATAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009772.2-3149s21c1
Sequence:CCGGCGGATTGTCATAATCTTCCATCTCGAGATGGAAGATTATGACAATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009772.2-1915s21c1
Sequence:CCGGCCAGCAGATTTAGTACAGATTCTCGAGAATCTGTACTAAATCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009772.1-1861s1c1
Sequence:CCGGCCAGCAGATTTAGTACAGATTCTCGAGAATCTGTACTAAATCTGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009772.1-448s1c1
Sequence:CCGGGCTGAACCTAAAGAACTACTACTCGAGTAGTAGTTCTTTAGGTTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009772.1-1453s1c1
Sequence:CCGGGCTCCAACACTTCCTGACATTCTCGAGAATGTCAGGAAGTGTTGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009772.1-3095s1c1
Sequence:CCGGCGGATTGTCATAATCTTCCATCTCGAGATGGAAGATTATGACAATCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009772.1-2673s1c1
Sequence:CCGGCGCTATCAGAATGCTTTACATCTCGAGATGTAAAGCATTCTGATAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009772
VALIDATED
BUB1 MISSION shRNA shRNA Plasmid DNA
BUB1 mitotic checkpoint serine/threonine kinase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009772.2-502s21c1
Sequence:CCGGGCTGAACCTAAAGAACTACTACTCGAGTAGTAGTTCTTTAGGTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009772.2-1507s21c1
Sequence:CCGGGCTCCAACACTTCCTGACATTCTCGAGAATGTCAGGAAGTGTTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009772.2-2727s21c1
Sequence:CCGGCGCTATCAGAATGCTTTACATCTCGAGATGTAAAGCATTCTGATAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009772.2-3149s21c1
Sequence:CCGGCGGATTGTCATAATCTTCCATCTCGAGATGGAAGATTATGACAATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009772.2-1915s21c1
Sequence:CCGGCCAGCAGATTTAGTACAGATTCTCGAGAATCTGTACTAAATCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009772.1-1861s1c1
Sequence:CCGGCCAGCAGATTTAGTACAGATTCTCGAGAATCTGTACTAAATCTGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009772.1-448s1c1
Sequence:CCGGGCTGAACCTAAAGAACTACTACTCGAGTAGTAGTTCTTTAGGTTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009772.1-1453s1c1
Sequence:CCGGGCTCCAACACTTCCTGACATTCTCGAGAATGTCAGGAAGTGTTGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009772.1-3095s1c1
Sequence:CCGGCGGATTGTCATAATCTTCCATCTCGAGATGGAAGATTATGACAATCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009772.1-2673s1c1
Sequence:CCGGCGCTATCAGAATGCTTTACATCTCGAGATGTAAAGCATTCTGATAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009772
VALIDATED
BUB1 MISSION shRNA Lentiviral Transduction Particles
BUB1 mitotic checkpoint serine/threonine kinase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009772.2-502s21c1
Sequence:CCGGGCTGAACCTAAAGAACTACTACTCGAGTAGTAGTTCTTTAGGTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009772.2-1507s21c1
Sequence:CCGGGCTCCAACACTTCCTGACATTCTCGAGAATGTCAGGAAGTGTTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009772.2-2727s21c1
Sequence:CCGGCGCTATCAGAATGCTTTACATCTCGAGATGTAAAGCATTCTGATAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009772.2-3149s21c1
Sequence:CCGGCGGATTGTCATAATCTTCCATCTCGAGATGGAAGATTATGACAATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009772.2-1915s21c1
Sequence:CCGGCCAGCAGATTTAGTACAGATTCTCGAGAATCTGTACTAAATCTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009772.1-1861s1c1
Sequence:CCGGCCAGCAGATTTAGTACAGATTCTCGAGAATCTGTACTAAATCTGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009772.1-448s1c1
Sequence:CCGGGCTGAACCTAAAGAACTACTACTCGAGTAGTAGTTCTTTAGGTTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009772.1-1453s1c1
Sequence:CCGGGCTCCAACACTTCCTGACATTCTCGAGAATGTCAGGAAGTGTTGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009772.1-3095s1c1
Sequence:CCGGCGGATTGTCATAATCTTCCATCTCGAGATGGAAGATTATGACAATCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009772.1-2673s1c1
Sequence:CCGGCGCTATCAGAATGCTTTACATCTCGAGATGTAAAGCATTCTGATAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004336
VALIDATED
BUB1 MISSION shRNA Bacterial Glycerol Stock
BUB1 mitotic checkpoint serine/threonine kinase
Human
20 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004336.3-344s21c1
Sequence:CCGGTACAACAGTGACCTCCATCAACTCGAGTTGATGGAGGTCACTGTTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004336.3-2950s21c1
Sequence:CCGGCCTGGGTCAGAGTATAGATATCTCGAGATATCTATACTCTGACCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004336.3-520s21c1
Sequence:CCGGGCAACAACAATACAGGTTATTCTCGAGAATAACCTGTATTGTTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004336.3-2380s21c1
Sequence:CCGGACCAGTGAGTTCCTATCCAAACTCGAGTTTGGATAGGAACTCACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004336.3-3054s21c1
Sequence:CCGGCATGGAACTACCAGATCGATTCTCGAGAATCGATCTGGTAGTTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004336.x-1478s1c1
Sequence:CCGGGCTCCTACACTTCCTGATATTCTCGAGAATATCAGGAAGTGTAGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004336.x-281s1c1
Sequence:CCGGTACAACAGTGACCTCCATCAACTCGAGTTGATGGAGGTCACTGTTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004336.x-2991s1c1
Sequence:CCGGCATGGAACTACCAGATCGATTCTCGAGAATCGATCTGGTAGTTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004336.x-819s1c1
Sequence:CCGGAGAAATACAATCAACGGAGAACTCGAGTTCTCCGTTGATTGTATTTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004336.x-2317s1c1
Sequence:CCGGACCAGTGAGTTCCTATCCAAACTCGAGTTTGGATAGGAACTCACTGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004336.x-1003s1c1
Sequence:CCGGCGAGGTTAATCCAGCACGTATCTCGAGATACGTGCTGGATTAACCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004336.x-3343s1c1
Sequence:CCGGTAAATATGAATCTGCTCACTTCTCGAGAAGTGAGCAGATTCATATTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040153    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_004336.1-3343s1c1
Sequence:CCGGAAATATGAATCTGCTCACTTCCTCGAGGAAGTGAGCAGATTCATATTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004336.1-457s1c1
Sequence:CCGGGCAACAACAATACAGGTTATTCTCGAGAATAACCTGTATTGTTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004336.1-2203s1c1
Sequence:CCGGCCAAGCAGAATGGATGCAGATCTCGAGATCTGCATCCATTCTGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004336.1-2887s1c1
Sequence:CCGGCCTGGGTCAGAGTATAGATATCTCGAGATATCTATACTCTGACCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004336.1-1490s1c1
Sequence:CCGGCCTGATATTTCTGATGACAAACTCGAGTTTGTCATCAGAAATATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004336.2-2427s1c1
Sequence:CCGGGAATTTCAATTGGGTTCTAAGCTCGAGCTTAGAACCCAATTGAAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004336.2-884s1c1
Sequence:CCGGGCATGAGCAATGGGTAAATGACTCGAGTCATTTACCCATTGCTCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004336.2-207s1c1
Sequence:CCGGCCTGAGAATAAAGAATACTTGCTCGAGCAAGTATTCTTTATTCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004336
VALIDATED
BUB1 MISSION shRNA shRNA Plasmid DNA
BUB1 mitotic checkpoint serine/threonine kinase
Human
20 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004336.3-344s21c1
Sequence:CCGGTACAACAGTGACCTCCATCAACTCGAGTTGATGGAGGTCACTGTTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004336.3-2950s21c1
Sequence:CCGGCCTGGGTCAGAGTATAGATATCTCGAGATATCTATACTCTGACCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004336.3-520s21c1
Sequence:CCGGGCAACAACAATACAGGTTATTCTCGAGAATAACCTGTATTGTTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004336.3-2380s21c1
Sequence:CCGGACCAGTGAGTTCCTATCCAAACTCGAGTTTGGATAGGAACTCACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004336.3-3054s21c1
Sequence:CCGGCATGGAACTACCAGATCGATTCTCGAGAATCGATCTGGTAGTTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004336.x-1478s1c1
Sequence:CCGGGCTCCTACACTTCCTGATATTCTCGAGAATATCAGGAAGTGTAGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004336.x-281s1c1
Sequence:CCGGTACAACAGTGACCTCCATCAACTCGAGTTGATGGAGGTCACTGTTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004336.x-2991s1c1
Sequence:CCGGCATGGAACTACCAGATCGATTCTCGAGAATCGATCTGGTAGTTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004336.x-819s1c1
Sequence:CCGGAGAAATACAATCAACGGAGAACTCGAGTTCTCCGTTGATTGTATTTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004336.x-2317s1c1
Sequence:CCGGACCAGTGAGTTCCTATCCAAACTCGAGTTTGGATAGGAACTCACTGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004336.x-1003s1c1
Sequence:CCGGCGAGGTTAATCCAGCACGTATCTCGAGATACGTGCTGGATTAACCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004336.x-3343s1c1
Sequence:CCGGTAAATATGAATCTGCTCACTTCTCGAGAAGTGAGCAGATTCATATTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040153    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_004336.1-3343s1c1
Sequence:CCGGAAATATGAATCTGCTCACTTCCTCGAGGAAGTGAGCAGATTCATATTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004336.1-457s1c1
Sequence:CCGGGCAACAACAATACAGGTTATTCTCGAGAATAACCTGTATTGTTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004336.1-2203s1c1
Sequence:CCGGCCAAGCAGAATGGATGCAGATCTCGAGATCTGCATCCATTCTGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004336.1-2887s1c1
Sequence:CCGGCCTGGGTCAGAGTATAGATATCTCGAGATATCTATACTCTGACCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004336.1-1490s1c1
Sequence:CCGGCCTGATATTTCTGATGACAAACTCGAGTTTGTCATCAGAAATATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004336.2-2427s1c1
Sequence:CCGGGAATTTCAATTGGGTTCTAAGCTCGAGCTTAGAACCCAATTGAAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004336.2-884s1c1
Sequence:CCGGGCATGAGCAATGGGTAAATGACTCGAGTCATTTACCCATTGCTCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004336.2-207s1c1
Sequence:CCGGCCTGAGAATAAAGAATACTTGCTCGAGCAAGTATTCTTTATTCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004336
VALIDATED
BUB1 MISSION shRNA Lentiviral Transduction Particles
BUB1 mitotic checkpoint serine/threonine kinase
Human
20 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004336.3-344s21c1
Sequence:CCGGTACAACAGTGACCTCCATCAACTCGAGTTGATGGAGGTCACTGTTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004336.3-2950s21c1
Sequence:CCGGCCTGGGTCAGAGTATAGATATCTCGAGATATCTATACTCTGACCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004336.3-520s21c1
Sequence:CCGGGCAACAACAATACAGGTTATTCTCGAGAATAACCTGTATTGTTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004336.3-2380s21c1
Sequence:CCGGACCAGTGAGTTCCTATCCAAACTCGAGTTTGGATAGGAACTCACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004336.3-3054s21c1
Sequence:CCGGCATGGAACTACCAGATCGATTCTCGAGAATCGATCTGGTAGTTCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004336.x-1478s1c1
Sequence:CCGGGCTCCTACACTTCCTGATATTCTCGAGAATATCAGGAAGTGTAGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004336.x-281s1c1
Sequence:CCGGTACAACAGTGACCTCCATCAACTCGAGTTGATGGAGGTCACTGTTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004336.x-2991s1c1
Sequence:CCGGCATGGAACTACCAGATCGATTCTCGAGAATCGATCTGGTAGTTCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004336.x-819s1c1
Sequence:CCGGAGAAATACAATCAACGGAGAACTCGAGTTCTCCGTTGATTGTATTTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004336.x-2317s1c1
Sequence:CCGGACCAGTGAGTTCCTATCCAAACTCGAGTTTGGATAGGAACTCACTGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004336.x-1003s1c1
Sequence:CCGGCGAGGTTAATCCAGCACGTATCTCGAGATACGTGCTGGATTAACCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004336.x-3343s1c1
Sequence:CCGGTAAATATGAATCTGCTCACTTCTCGAGAAGTGAGCAGATTCATATTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040153    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_004336.1-3343s1c1
Sequence:CCGGAAATATGAATCTGCTCACTTCCTCGAGGAAGTGAGCAGATTCATATTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004336.1-457s1c1
Sequence:CCGGGCAACAACAATACAGGTTATTCTCGAGAATAACCTGTATTGTTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004336.1-2203s1c1
Sequence:CCGGCCAAGCAGAATGGATGCAGATCTCGAGATCTGCATCCATTCTGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004336.1-2887s1c1
Sequence:CCGGCCTGGGTCAGAGTATAGATATCTCGAGATATCTATACTCTGACCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004336.1-1490s1c1
Sequence:CCGGCCTGATATTTCTGATGACAAACTCGAGTTTGTCATCAGAAATATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004336.2-2427s1c1
Sequence:CCGGGAATTTCAATTGGGTTCTAAGCTCGAGCTTAGAACCCAATTGAAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004336.2-884s1c1
Sequence:CCGGGCATGAGCAATGGGTAAATGACTCGAGTCATTTACCCATTGCTCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004336.2-207s1c1
Sequence:CCGGCCTGAGAATAAAGAATACTTGCTCGAGCAAGTATTCTTTATTCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)