EMAIL THIS PAGE TO A FRIEND

BUB1B

BUB1 mitotic checkpoint serine/threonine kinase B

85 Gene Product Result for
Synonyms: BUB1beta BUBR1 Bub1A MAD3L MVA1 SSK1 hBUBR1
Gene ID:
Human(701) Summary: This gene encodes a kinase involved in spindle checkpoint function. The protein has been localized to the kinetochore and plays a role in the inhibition of the anaphase-promoting complex/cyclosome (APC/C), delaying the onset of anaphase and ensuring proper chromosome segregation. Impaired spindle checkpoint function has been found in many forms of cancer. [provided by RefSeq, Jul 2008]
Mouse(12236) budding uninhibited by benzimidazoles 1 homolog, beta (S. cerevisiae)
Rat(171576) BUB1 mitotic checkpoint serine/threonine kinase B
sheep(101108313) budding uninhibited by benzimidazoles 1 homolog beta (yeast)
domestic guinea pig(100728730) BUB1 mitotic checkpoint serine/threonine kinase B
naked mole-rat(101705847) BUB1 mitotic checkpoint serine/threonine kinase B
chicken(378922) budding uninhibited by benzimidazoles 1 homolog beta (yeast)
dog(608350) budding uninhibited by benzimidazoles 1 homolog beta (yeast)
domestic cat(101087670) budding uninhibited by benzimidazoles 1 homolog beta (yeast)
cow(537027) budding uninhibited by benzimidazoles 1 homolog beta (yeast)
Horse(100629735) budding uninhibited by benzimidazoles 1 homolog beta (yeast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0009 AQUA Peptide LLPEEDLDV[K] human pricing
AQ0008 AQUA Peptide LQIASESQ[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001211 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001211 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001211 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009773 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009773 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009773 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU052101 MISSION® esiRNA esiRNA human BUB1B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001211 siRNAs that have been validated in the lab human pricing
XM_001080736 Rosetta Predictions rat pricing
XM_342494 Rosetta Predictions rat pricing
NM_009773 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001211 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206893 validated 3305
1 SASI_Hs01_00206892 validated 687
1 SASI_Hs01_00206894 validated 579
2 SASI_Hs02_00331353 predicted 3421
3 SASI_Hs01_00206896 predicted 1643
4 SASI_Hs01_00206897 predicted 2452
5 SASI_Hs01_00206898 predicted 494
6 SASI_Hs01_00206899 predicted 1048
7 SASI_Hs02_00331354 predicted 888
8 SASI_Hs01_00206900 predicted 433
9 SASI_Hs01_00206901 predicted 1180
10 SASI_Hs01_00206895 predicted 2761
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080736 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369120 predicted 203
2 SASI_Rn02_00369121 predicted 258
3 SASI_Rn02_00369122 predicted 2247
4 SASI_Rn02_00369123 predicted 369
5 SASI_Rn02_00369124 predicted 275
6 SASI_Rn02_00369125 predicted 2036
7 SASI_Rn02_00369126 predicted 2439
8 SASI_Rn02_00369127 predicted 2745
9 SASI_Rn02_00369128 predicted 1412
10 SASI_Rn02_00369129 predicted 2226
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342494 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394369 predicted 690
2 SASI_Rn02_00394370 predicted 752
3 SASI_Rn02_00394371 predicted 2742
4 SASI_Rn02_00394372 predicted 865
5 SASI_Rn02_00394373 predicted 767
6 SASI_Rn02_00394374 predicted 2531
7 SASI_Rn02_00394375 predicted 2935
8 SASI_Rn02_00394376 predicted 3233
9 SASI_Rn02_00394377 predicted 1899
10 SASI_Rn02_00394378 predicted 2716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009773 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053112 predicted 2403
2 SASI_Mm01_00053113 predicted 440
3 SASI_Mm01_00053114 predicted 2676
4 SASI_Mm01_00053115 predicted 2941
5 SASI_Mm01_00053116 predicted 2064
6 SASI_Mm01_00053117 predicted 2569
7 SASI_Mm01_00053118 predicted 515
8 SASI_Mm01_00053120 predicted 1226
9 SASI_Mm01_00053121 predicted 2980
10 SASI_Mm02_00316991 predicted 500
11 SASI_Mm01_00053119 predicted 1673
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001211
VALIDATED
BUB1B MISSION shRNA Bacterial Glycerol Stock
BUB1 mitotic checkpoint serine/threonine kinase B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197142    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001211.4-3388s1c1
Sequence:CCGGGTGGAACACTGAAACTGTATGCTCGAGCATACAGTTTCAGTGTTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001211.4-1668s1c1
Sequence:CCGGCCAGTTCTGTTTGTCAAGTAACTCGAGTTACTTGACAAACAGAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001211.4-467s1c1
Sequence:CCGGGAGAGTAATATGTCAACGTTACTCGAGTAACGTTGACATATTACTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001211.4-2545s1c1
Sequence:CCGGCTCTGCAGAATTAACAGTAATCTCGAGATTACTGTTAATTCTGCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001211.4-2677s1c1
Sequence:CCGGCTGTATTGTTTGGCACCAATACTCGAGTATTGGTGCCAAACAATACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001211.x-1705s1c1
Sequence:CCGGCCAGTGTACCTTTCTCCATTTCTCGAGAAATGGAGAAAGGTACACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001211.x-1822s1c1
Sequence:CCGGCCTCAGAAAGCATCACCTCAACTCGAGTTGAGGTGATGCTTTCTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000461    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001211.x-3346s1c1
Sequence:CCGGCTGAAACTGTATGTGCTGTAACTCGAGTTACAGCACATACAGTTTCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001211.x-521s1c1
Sequence:CCGGGCGTTTATGCAATGAGCCTTTCTCGAGAAAGGCTCATTGCATAAACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001211.x-1560s1c1
Sequence:CCGGGAGACAACTAAACTGCAAATTCTCGAGAATTTGCAGTTTAGTTGTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001211
VALIDATED
BUB1B MISSION shRNA shRNA Plasmid DNA
BUB1 mitotic checkpoint serine/threonine kinase B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197142    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001211.4-3388s1c1
Sequence:CCGGGTGGAACACTGAAACTGTATGCTCGAGCATACAGTTTCAGTGTTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001211.4-1668s1c1
Sequence:CCGGCCAGTTCTGTTTGTCAAGTAACTCGAGTTACTTGACAAACAGAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001211.4-467s1c1
Sequence:CCGGGAGAGTAATATGTCAACGTTACTCGAGTAACGTTGACATATTACTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001211.4-2545s1c1
Sequence:CCGGCTCTGCAGAATTAACAGTAATCTCGAGATTACTGTTAATTCTGCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001211.4-2677s1c1
Sequence:CCGGCTGTATTGTTTGGCACCAATACTCGAGTATTGGTGCCAAACAATACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001211.x-1705s1c1
Sequence:CCGGCCAGTGTACCTTTCTCCATTTCTCGAGAAATGGAGAAAGGTACACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001211.x-1822s1c1
Sequence:CCGGCCTCAGAAAGCATCACCTCAACTCGAGTTGAGGTGATGCTTTCTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000461    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001211.x-3346s1c1
Sequence:CCGGCTGAAACTGTATGTGCTGTAACTCGAGTTACAGCACATACAGTTTCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001211.x-521s1c1
Sequence:CCGGGCGTTTATGCAATGAGCCTTTCTCGAGAAAGGCTCATTGCATAAACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001211.x-1560s1c1
Sequence:CCGGGAGACAACTAAACTGCAAATTCTCGAGAATTTGCAGTTTAGTTGTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001211
VALIDATED
BUB1B MISSION shRNA Lentiviral Transduction Particles
BUB1 mitotic checkpoint serine/threonine kinase B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197142    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001211.4-3388s1c1
Sequence:CCGGGTGGAACACTGAAACTGTATGCTCGAGCATACAGTTTCAGTGTTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001211.4-1668s1c1
Sequence:CCGGCCAGTTCTGTTTGTCAAGTAACTCGAGTTACTTGACAAACAGAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001211.4-467s1c1
Sequence:CCGGGAGAGTAATATGTCAACGTTACTCGAGTAACGTTGACATATTACTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001211.4-2545s1c1
Sequence:CCGGCTCTGCAGAATTAACAGTAATCTCGAGATTACTGTTAATTCTGCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001211.4-2677s1c1
Sequence:CCGGCTGTATTGTTTGGCACCAATACTCGAGTATTGGTGCCAAACAATACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001211.x-1705s1c1
Sequence:CCGGCCAGTGTACCTTTCTCCATTTCTCGAGAAATGGAGAAAGGTACACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001211.x-1822s1c1
Sequence:CCGGCCTCAGAAAGCATCACCTCAACTCGAGTTGAGGTGATGCTTTCTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000461    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001211.x-3346s1c1
Sequence:CCGGCTGAAACTGTATGTGCTGTAACTCGAGTTACAGCACATACAGTTTCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001211.x-521s1c1
Sequence:CCGGGCGTTTATGCAATGAGCCTTTCTCGAGAAAGGCTCATTGCATAAACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001211.x-1560s1c1
Sequence:CCGGGAGACAACTAAACTGCAAATTCTCGAGAATTTGCAGTTTAGTTGTCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009773
VALIDATED
BUB1B MISSION shRNA Bacterial Glycerol Stock
BUB1 mitotic checkpoint serine/threonine kinase B
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009773.1-3402s1c1
Sequence:CCGGGCACACTTAGACACATCAGCACTCGAGTGCTGATGTGTCTAAGTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009773.1-593s1c1
Sequence:CCGGGCTATTTACAAAGCCAAGGAACTCGAGTTCCTTGGCTTTGTAAATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009773.1-2711s1c1
Sequence:CCGGGCGAATTTGTTACTCATGAAACTCGAGTTTCATGAGTAACAAATTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009773.1-2358s1c1
Sequence:CCGGCCTACTAGAATTAAGTGCTTTCTCGAGAAAGCACTTAATTCTAGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009773.1-1024s1c1
Sequence:CCGGCCGGAGTTATCTAAGCCTGTACTCGAGTACAGGCTTAGATAACTCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009773.3-3403s21c1
Sequence:CCGGGGTATGGTGAAGAACTGGTCTCTCGAGAGACCAGTTCTTCACCATACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009773.3-547s21c1
Sequence:CCGGCAAGGAGAGACGCGCTATTATCTCGAGATAATAGCGCGTCTCTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009773.3-1928s21c1
Sequence:CCGGAGGATGTGTCTCCCGATATTTCTCGAGAAATATCGGGAGACACATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009773.3-2526s21c1
Sequence:CCGGATGTGACGATTACAGGTTATTCTCGAGAATAACCTGTAATCGTCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009773.3-2184s21c1
Sequence:CCGGTCACCAGGCCCTCATCATAAACTCGAGTTTATGATGAGGGCCTGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373993    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009773.3-3485s21c1
Sequence:CCGGACTCTCAGTAGCACAGCTTTCCTCGAGGAAAGCTGTGCTACTGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009773.3-1058s21c1
Sequence:CCGGCCGCGTCTAGAACGGAGTTATCTCGAGATAACTCCGTTCTAGACGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009773
VALIDATED
BUB1B MISSION shRNA shRNA Plasmid DNA
BUB1 mitotic checkpoint serine/threonine kinase B
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009773.1-3402s1c1
Sequence:CCGGGCACACTTAGACACATCAGCACTCGAGTGCTGATGTGTCTAAGTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009773.1-593s1c1
Sequence:CCGGGCTATTTACAAAGCCAAGGAACTCGAGTTCCTTGGCTTTGTAAATAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009773.1-2711s1c1
Sequence:CCGGGCGAATTTGTTACTCATGAAACTCGAGTTTCATGAGTAACAAATTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009773.1-2358s1c1
Sequence:CCGGCCTACTAGAATTAAGTGCTTTCTCGAGAAAGCACTTAATTCTAGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009773.1-1024s1c1
Sequence:CCGGCCGGAGTTATCTAAGCCTGTACTCGAGTACAGGCTTAGATAACTCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009773.3-3403s21c1
Sequence:CCGGGGTATGGTGAAGAACTGGTCTCTCGAGAGACCAGTTCTTCACCATACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009773.3-547s21c1
Sequence:CCGGCAAGGAGAGACGCGCTATTATCTCGAGATAATAGCGCGTCTCTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009773.3-1928s21c1
Sequence:CCGGAGGATGTGTCTCCCGATATTTCTCGAGAAATATCGGGAGACACATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009773.3-2526s21c1
Sequence:CCGGATGTGACGATTACAGGTTATTCTCGAGAATAACCTGTAATCGTCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009773.3-2184s21c1
Sequence:CCGGTCACCAGGCCCTCATCATAAACTCGAGTTTATGATGAGGGCCTGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373993    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009773.3-3485s21c1
Sequence:CCGGACTCTCAGTAGCACAGCTTTCCTCGAGGAAAGCTGTGCTACTGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009773.3-1058s21c1
Sequence:CCGGCCGCGTCTAGAACGGAGTTATCTCGAGATAACTCCGTTCTAGACGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009773
VALIDATED
BUB1B MISSION shRNA Lentiviral Transduction Particles
BUB1 mitotic checkpoint serine/threonine kinase B
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009773.1-3402s1c1
Sequence:CCGGGCACACTTAGACACATCAGCACTCGAGTGCTGATGTGTCTAAGTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009773.1-593s1c1
Sequence:CCGGGCTATTTACAAAGCCAAGGAACTCGAGTTCCTTGGCTTTGTAAATAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009773.1-2711s1c1
Sequence:CCGGGCGAATTTGTTACTCATGAAACTCGAGTTTCATGAGTAACAAATTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009773.1-2358s1c1
Sequence:CCGGCCTACTAGAATTAAGTGCTTTCTCGAGAAAGCACTTAATTCTAGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009773.1-1024s1c1
Sequence:CCGGCCGGAGTTATCTAAGCCTGTACTCGAGTACAGGCTTAGATAACTCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009773.3-3403s21c1
Sequence:CCGGGGTATGGTGAAGAACTGGTCTCTCGAGAGACCAGTTCTTCACCATACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009773.3-547s21c1
Sequence:CCGGCAAGGAGAGACGCGCTATTATCTCGAGATAATAGCGCGTCTCTCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009773.3-1928s21c1
Sequence:CCGGAGGATGTGTCTCCCGATATTTCTCGAGAAATATCGGGAGACACATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009773.3-2526s21c1
Sequence:CCGGATGTGACGATTACAGGTTATTCTCGAGAATAACCTGTAATCGTCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009773.3-2184s21c1
Sequence:CCGGTCACCAGGCCCTCATCATAAACTCGAGTTTATGATGAGGGCCTGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373993    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009773.3-3485s21c1
Sequence:CCGGACTCTCAGTAGCACAGCTTTCCTCGAGGAAAGCTGTGCTACTGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009773.3-1058s21c1
Sequence:CCGGCCGCGTCTAGAACGGAGTTATCTCGAGATAACTCCGTTCTAGACGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)