EMAIL THIS PAGE TO A FRIEND

BUB3

BUB3 mitotic checkpoint protein

152 Gene Product Result for
Synonyms: BUB3L hBUB3
UniProtKB ID: O43684, A6NJ42, B2R6E7, D3DRE9, O43685
Gene ID:
Human(9184) Summary: This gene encodes a protein involved in spindle checkpoint function. The encoded protein contains four WD repeat domains and has sequence similarity with the yeast BUB3 protein. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(12237) budding uninhibited by benzimidazoles 3 homolog (S. cerevisiae)
Rat(361662) BUB3 mitotic checkpoint protein
Zebrafish(403012) BUB3 budding uninhibited by benzimidazoles 3 homolog (yeast)
chicken(423949) budding uninhibited by benzimidazoles 3 homolog (yeast)
cow(539594) budding uninhibited by benzimidazoles 3 homolog (yeast)
Horse(100050269) budding uninhibited by benzimidazoles 3 homolog (yeast)
domestic cat(101093300) budding uninhibited by benzimidazoles 3 homolog (yeast)
dog(477857) budding uninhibited by benzimidazoles 3 homolog (yeast)
fruit fly(43490) CG7581 gene product from transcript CG7581-RA
naked mole-rat(101697549) BUB3 mitotic checkpoint protein
domestic guinea pig(100735802) BUB3 mitotic checkpoint protein
sheep(101113551) budding uninhibited by benzimidazoles 3 homolog (yeast)
Domestic Rabbit(100352365) budding uninhibited by benzimidazoles 3 homolog (yeast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB3500443 Anti-Bub3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, immunocytochemistry, western blot pricing
B7811 Anti-BUB3 antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human, rat, mouse
immunofluorescence, immunoprecipitation, western blot pricing
HPA003601 Anti-BUB3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2103777 Anti-BUB3, (N-terminal) antibody produced in rabbit affinity isolated antibody human, rabbit, bovine, horse, mouse, rat, guinea pig
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009774 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009774 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009774 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004725 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004725 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004725 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007793 Rosetta Predictions human pricing
NM_004725 Rosetta Predictions human pricing
NM_001047906 Rosetta Predictions rat pricing
NM_009774 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007793 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201431 predicted 469
2 SASI_Hs01_00201432 predicted 602
3 SASI_Hs01_00201433 predicted 262
4 SASI_Hs01_00201434 predicted 483
5 SASI_Hs01_00201435 predicted 419
6 SASI_Hs01_00201436 predicted 493
7 SASI_Hs01_00201437 predicted 510
8 SASI_Hs01_00201438 predicted 345
9 SASI_Hs01_00201439 predicted 216
10 SASI_Hs01_00201440 predicted 593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004725 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233906 predicted 469
2 SASI_Hs01_00233907 predicted 598
3 SASI_Hs01_00233908 predicted 265
4 SASI_Hs01_00233909 predicted 486
5 SASI_Hs01_00233910 predicted 416
6 SASI_Hs01_00233911 predicted 495
7 SASI_Hs01_00233912 predicted 508
8 SASI_Hs01_00233913 predicted 344
9 SASI_Hs01_00233914 predicted 216
10 SASI_Hs01_00233915 predicted 599
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047906 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206675 predicted 275
2 SASI_Rn02_00206676 predicted 795
3 SASI_Rn02_00206677 predicted 808
4 SASI_Rn02_00206678 predicted 390
5 SASI_Rn02_00206679 predicted 487
6 SASI_Rn02_00206680 predicted 433
7 SASI_Rn02_00206681 predicted 654
8 SASI_Rn02_00206682 predicted 362
9 SASI_Rn02_00206683 predicted 569
10 SASI_Rn02_00206684 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009774 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092698 predicted 439
2 SASI_Mm02_00316992 predicted 836
3 SASI_Mm01_00092699 predicted 353
4 SASI_Mm01_00092700 predicted 375
5 SASI_Mm02_00316993 predicted 713
6 SASI_Mm02_00316994 predicted 626
7 SASI_Mm02_00316995 predicted 640
8 SASI_Mm01_00092701 predicted 281
9 SASI_Mm01_00092702 predicted 278
10 SASI_Mm01_00092703 predicted 731
11 SASI_Mm01_00092697 predicted 954
12 SASI_Mm01_00092704 predicted 380
13 SASI_Mm01_00092705 predicted 1129
14 SASI_Mm01_00092706 predicted 248
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009774
VALIDATED
BUB3 MISSION shRNA Bacterial Glycerol Stock
BUB3 mitotic checkpoint protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009774.3-934s21c1
Sequence:CCGGGCTTGCAATAGCATCGTCATACTCGAGTATGACGATGCTATTGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009774.3-835s21c1
Sequence:CCGGCGTCAATATTTGGGACCCATTCTCGAGAATGGGTCCCAAATATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009774.3-380s21c1
Sequence:CCGGCCAGAAGTGAACGTGATGGTACTCGAGTACCATCACGTTCACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009774.3-912s21c1
Sequence:CCGGCCTTCAGTAATGACGGAACTACTCGAGTAGTTCCGTCATTACTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009774.2-836s1c1
Sequence:CCGGCGTCAATATTTGGGACCCATTCTCGAGAATGGGTCCCAAATATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009774.2-913s1c1
Sequence:CCGGCCTTCAGTAATGACGGAACTACTCGAGTAGTTCCGTCATTACTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123819    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009774.2-1868s1c1
Sequence:CCGGGCCTTGTTAAAGGTGACCAAACTCGAGTTTGGTCACCTTTAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009774.2-381s1c1
Sequence:CCGGCCAGAAGTGAACGTGATGGTACTCGAGTACCATCACGTTCACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009774.2-935s1c1
Sequence:CCGGGCTTGCAATAGCATCGTCATACTCGAGTATGACGATGCTATTGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009774
VALIDATED
BUB3 MISSION shRNA shRNA Plasmid DNA
BUB3 mitotic checkpoint protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009774.3-934s21c1
Sequence:CCGGGCTTGCAATAGCATCGTCATACTCGAGTATGACGATGCTATTGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009774.3-835s21c1
Sequence:CCGGCGTCAATATTTGGGACCCATTCTCGAGAATGGGTCCCAAATATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009774.3-380s21c1
Sequence:CCGGCCAGAAGTGAACGTGATGGTACTCGAGTACCATCACGTTCACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009774.3-912s21c1
Sequence:CCGGCCTTCAGTAATGACGGAACTACTCGAGTAGTTCCGTCATTACTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009774.2-836s1c1
Sequence:CCGGCGTCAATATTTGGGACCCATTCTCGAGAATGGGTCCCAAATATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009774.2-913s1c1
Sequence:CCGGCCTTCAGTAATGACGGAACTACTCGAGTAGTTCCGTCATTACTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123819    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009774.2-1868s1c1
Sequence:CCGGGCCTTGTTAAAGGTGACCAAACTCGAGTTTGGTCACCTTTAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009774.2-381s1c1
Sequence:CCGGCCAGAAGTGAACGTGATGGTACTCGAGTACCATCACGTTCACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009774.2-935s1c1
Sequence:CCGGGCTTGCAATAGCATCGTCATACTCGAGTATGACGATGCTATTGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009774
VALIDATED
BUB3 MISSION shRNA Lentiviral Transduction Particles
BUB3 mitotic checkpoint protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009774.3-934s21c1
Sequence:CCGGGCTTGCAATAGCATCGTCATACTCGAGTATGACGATGCTATTGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009774.3-835s21c1
Sequence:CCGGCGTCAATATTTGGGACCCATTCTCGAGAATGGGTCCCAAATATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009774.3-380s21c1
Sequence:CCGGCCAGAAGTGAACGTGATGGTACTCGAGTACCATCACGTTCACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009774.3-912s21c1
Sequence:CCGGCCTTCAGTAATGACGGAACTACTCGAGTAGTTCCGTCATTACTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009774.2-836s1c1
Sequence:CCGGCGTCAATATTTGGGACCCATTCTCGAGAATGGGTCCCAAATATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009774.2-913s1c1
Sequence:CCGGCCTTCAGTAATGACGGAACTACTCGAGTAGTTCCGTCATTACTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123819    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009774.2-1868s1c1
Sequence:CCGGGCCTTGTTAAAGGTGACCAAACTCGAGTTTGGTCACCTTTAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009774.2-381s1c1
Sequence:CCGGCCAGAAGTGAACGTGATGGTACTCGAGTACCATCACGTTCACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009774.2-935s1c1
Sequence:CCGGGCTTGCAATAGCATCGTCATACTCGAGTATGACGATGCTATTGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004725
BUB3 MISSION shRNA Bacterial Glycerol Stock
BUB3 mitotic checkpoint protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004725.2-1005s21c1
Sequence:CCGGTGCAATAGCGTCATCATATATCTCGAGATATATGATGACGCTATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004725.2-348s21c1
Sequence:GTACCGGTGGAGGACTAGATCATCAATTCTCGAGAATTGATGATCTAGTCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004725.2-1997s21c1
Sequence:CCGGGACCAGCCGCTGGTGATTAAACTCGAGTTTAATCACCAGCGGCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004725.2-735s21c1
Sequence:CCGGCCGAGTGGCAGTTGAGTATTTCTCGAGAAATACTCAACTGCCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004725.2-709s21c1
Sequence:CCGGGGTTATGTATTAAGCTCTATTCTCGAGAATAGAGCTTAATACATAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004725.2-2333s1c1
Sequence:CCGGCCACCTAATCATCCTGTGAAACTCGAGTTTCACAGGATGATTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004725.2-680s1c1
Sequence:CCGGGCTGCATACGAGCGTTTCCAACTCGAGTTGGAAACGCTCGTATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004725.2-980s1c1
Sequence:CCGGCCTTCAGTAATGATGGGACTACTCGAGTAGTCCCATCATTACTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004725.2-791s1c1
Sequence:CCGGCCTTCAAATGTCACAGACTAACTCGAGTTAGTCTGTGACATTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004725.2-1073s1c1
Sequence:CCGGGCCAAGTGACAGATGCAGAAACTCGAGTTTCTGCATCTGTCACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004725
BUB3 MISSION shRNA shRNA Plasmid DNA
BUB3 mitotic checkpoint protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004725.2-1005s21c1
Sequence:CCGGTGCAATAGCGTCATCATATATCTCGAGATATATGATGACGCTATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004725.2-348s21c1
Sequence:GTACCGGTGGAGGACTAGATCATCAATTCTCGAGAATTGATGATCTAGTCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004725.2-1997s21c1
Sequence:CCGGGACCAGCCGCTGGTGATTAAACTCGAGTTTAATCACCAGCGGCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004725.2-735s21c1
Sequence:CCGGCCGAGTGGCAGTTGAGTATTTCTCGAGAAATACTCAACTGCCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004725.2-709s21c1
Sequence:CCGGGGTTATGTATTAAGCTCTATTCTCGAGAATAGAGCTTAATACATAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004725.2-2333s1c1
Sequence:CCGGCCACCTAATCATCCTGTGAAACTCGAGTTTCACAGGATGATTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004725.2-680s1c1
Sequence:CCGGGCTGCATACGAGCGTTTCCAACTCGAGTTGGAAACGCTCGTATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004725.2-980s1c1
Sequence:CCGGCCTTCAGTAATGATGGGACTACTCGAGTAGTCCCATCATTACTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004725.2-791s1c1
Sequence:CCGGCCTTCAAATGTCACAGACTAACTCGAGTTAGTCTGTGACATTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004725.2-1073s1c1
Sequence:CCGGGCCAAGTGACAGATGCAGAAACTCGAGTTTCTGCATCTGTCACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004725
BUB3 MISSION shRNA Lentiviral Transduction Particles
BUB3 mitotic checkpoint protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004725.2-1005s21c1
Sequence:CCGGTGCAATAGCGTCATCATATATCTCGAGATATATGATGACGCTATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004725.2-348s21c1
Sequence:GTACCGGTGGAGGACTAGATCATCAATTCTCGAGAATTGATGATCTAGTCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004725.2-1997s21c1
Sequence:CCGGGACCAGCCGCTGGTGATTAAACTCGAGTTTAATCACCAGCGGCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004725.2-735s21c1
Sequence:CCGGCCGAGTGGCAGTTGAGTATTTCTCGAGAAATACTCAACTGCCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004725.2-709s21c1
Sequence:CCGGGGTTATGTATTAAGCTCTATTCTCGAGAATAGAGCTTAATACATAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004725.2-2333s1c1
Sequence:CCGGCCACCTAATCATCCTGTGAAACTCGAGTTTCACAGGATGATTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004725.2-680s1c1
Sequence:CCGGGCTGCATACGAGCGTTTCCAACTCGAGTTGGAAACGCTCGTATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004725.2-980s1c1
Sequence:CCGGCCTTCAGTAATGATGGGACTACTCGAGTAGTCCCATCATTACTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004725.2-791s1c1
Sequence:CCGGCCTTCAAATGTCACAGACTAACTCGAGTTAGTCTGTGACATTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004725.2-1073s1c1
Sequence:CCGGGCCAAGTGACAGATGCAGAAACTCGAGTTTCTGCATCTGTCACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks