EMAIL THIS PAGE TO A FRIEND

BUD13

BUD13 homolog (S. cerevisiae)

53 Gene Product Result for
Synonyms: Cwc26 fSAP71
UniProtKB ID: Q9BRD0, A8K0S0, Q96LS7
Gene ID:
Mouse(215051) BUD13 homolog (yeast)
Rat(300687) BUD13 homolog (S. cerevisiae)
chicken(428248) BUD13 homolog (S. cerevisiae)
dog(479429) BUD13 homolog (S. cerevisiae)
domestic cat(101084900) BUD13 homolog (S. cerevisiae)
cow(510313) BUD13 homolog (S. cerevisiae)
sheep(101115900) BUD13 homolog (S. cerevisiae)
domestic guinea pig(100729931) BUD13 homolog (S. cerevisiae)
naked mole-rat(101724123) BUD13 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032725 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032725 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032725 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146000 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146000 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146000 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU037191 MISSION® esiRNA esiRNA human BUD13 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032725 Rosetta Predictions human pricing
NM_001025277 Rosetta Predictions rat pricing
NM_146000 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032725 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026485 predicted 838
2 SASI_Hs01_00026486 predicted 1031
3 SASI_Hs01_00026488 predicted 1856
4 SASI_Hs02_00360254 predicted 1169
5 SASI_Hs01_00026489 predicted 1405
6 SASI_Hs01_00026490 predicted 346
7 SASI_Hs01_00026491 predicted 1614
8 SASI_Hs01_00026492 predicted 888
9 SASI_Hs01_00026493 predicted 1841
10 SASI_Hs02_00360255 predicted 1406
11 SASI_Hs01_00026484 predicted 1786
12 SASI_Hs01_00026487 predicted 1497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025277 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074126 predicted 934
2 SASI_Rn01_00074127 predicted 1517
3 SASI_Rn02_00203105 predicted 1623
4 SASI_Rn01_00074128 predicted 894
5 SASI_Rn01_00074129 predicted 1418
6 SASI_Rn01_00074131 predicted 1409
7 SASI_Rn01_00074132 predicted 1193
8 SASI_Rn01_00074133 predicted 1156
9 SASI_Rn01_00074134 predicted 1426
10 SASI_Rn01_00074135 predicted 1254
11 SASI_Rn01_00074130 predicted 1724
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146000 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126639 predicted 907
2 SASI_Mm01_00126640 predicted 1587
3 SASI_Mm01_00126641 predicted 1590
4 SASI_Mm01_00126642 predicted 615
5 SASI_Mm01_00126643 predicted 1449
6 SASI_Mm01_00126644 predicted 750
7 SASI_Mm01_00126645 predicted 364
8 SASI_Mm01_00126646 predicted 382
9 SASI_Mm01_00126647 predicted 1413
10 SASI_Mm01_00126648 predicted 741
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032725
VALIDATED
BUD13 MISSION shRNA Bacterial Glycerol Stock
BUD13 homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074893    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_032725.2-2036s1c1
Sequence:CCGGCCTGATGTTTGGACTGAGGTACTCGAGTACCTCAGTCCAAACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032725.2-54s1c1
Sequence:CCGGCGAGTATCTGAAGCGTTACTTCTCGAGAAGTAACGCTTCAGATACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032725.2-1593s1c1
Sequence:CCGGCCGCTATATTGATGACGAAGACTCGAGTCTTCGTCATCAATATAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_032725.2-717s1c1
Sequence:CCGGCCGTCATGGTTCCTCAGATATCTCGAGATATCTGAGGAACCATGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032725.2-1591s1c1
Sequence:CCGGGCCCGCTATATTGATGACGAACTCGAGTTCGTCATCAATATAGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032725.3-1045s21c1
Sequence:CCGGAGACAAGAAGCAGCTTGATTCCTCGAGGAATCAAGCTGCTTCTTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032725.3-1449s21c1
Sequence:CCGGATTTGAAACTCGAACGTTTAGCTCGAGCTAAACGTTCGAGTTTCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032725.3-1403s21c1
Sequence:CCGGCAATATGCTGAAACCGTATTTCTCGAGAAATACGGTTTCAGCATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032725.3-975s21c1
Sequence:CCGGAGAACAGCAAATATGAGTATGCTCGAGCATACTCATATTTGCTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032725.3-1962s21c1
Sequence:CCGGACAGTTGTCTGTGCTAATAATCTCGAGATTATTAGCACAGACAACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032725.3-679s21c1
Sequence:CCGGTAGGAGAGTCCGTCATGATTCCTCGAGGAATCATGACGGACTCTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032725.3-1879s21c1
Sequence:CCGGTGTTGAGGATATGTAACTTTCCTCGAGGAAAGTTACATATCCTCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032725
VALIDATED
BUD13 MISSION shRNA shRNA Plasmid DNA
BUD13 homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074893    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_032725.2-2036s1c1
Sequence:CCGGCCTGATGTTTGGACTGAGGTACTCGAGTACCTCAGTCCAAACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032725.2-54s1c1
Sequence:CCGGCGAGTATCTGAAGCGTTACTTCTCGAGAAGTAACGCTTCAGATACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032725.2-1593s1c1
Sequence:CCGGCCGCTATATTGATGACGAAGACTCGAGTCTTCGTCATCAATATAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_032725.2-717s1c1
Sequence:CCGGCCGTCATGGTTCCTCAGATATCTCGAGATATCTGAGGAACCATGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032725.2-1591s1c1
Sequence:CCGGGCCCGCTATATTGATGACGAACTCGAGTTCGTCATCAATATAGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032725.3-1045s21c1
Sequence:CCGGAGACAAGAAGCAGCTTGATTCCTCGAGGAATCAAGCTGCTTCTTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032725.3-1449s21c1
Sequence:CCGGATTTGAAACTCGAACGTTTAGCTCGAGCTAAACGTTCGAGTTTCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032725.3-1403s21c1
Sequence:CCGGCAATATGCTGAAACCGTATTTCTCGAGAAATACGGTTTCAGCATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032725.3-975s21c1
Sequence:CCGGAGAACAGCAAATATGAGTATGCTCGAGCATACTCATATTTGCTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032725.3-1962s21c1
Sequence:CCGGACAGTTGTCTGTGCTAATAATCTCGAGATTATTAGCACAGACAACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032725.3-679s21c1
Sequence:CCGGTAGGAGAGTCCGTCATGATTCCTCGAGGAATCATGACGGACTCTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032725.3-1879s21c1
Sequence:CCGGTGTTGAGGATATGTAACTTTCCTCGAGGAAAGTTACATATCCTCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032725
VALIDATED
BUD13 MISSION shRNA Lentiviral Transduction Particles
BUD13 homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074893    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_032725.2-2036s1c1
Sequence:CCGGCCTGATGTTTGGACTGAGGTACTCGAGTACCTCAGTCCAAACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032725.2-54s1c1
Sequence:CCGGCGAGTATCTGAAGCGTTACTTCTCGAGAAGTAACGCTTCAGATACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032725.2-1593s1c1
Sequence:CCGGCCGCTATATTGATGACGAAGACTCGAGTCTTCGTCATCAATATAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_032725.2-717s1c1
Sequence:CCGGCCGTCATGGTTCCTCAGATATCTCGAGATATCTGAGGAACCATGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032725.2-1591s1c1
Sequence:CCGGGCCCGCTATATTGATGACGAACTCGAGTTCGTCATCAATATAGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032725.3-1045s21c1
Sequence:CCGGAGACAAGAAGCAGCTTGATTCCTCGAGGAATCAAGCTGCTTCTTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032725.3-1449s21c1
Sequence:CCGGATTTGAAACTCGAACGTTTAGCTCGAGCTAAACGTTCGAGTTTCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032725.3-1403s21c1
Sequence:CCGGCAATATGCTGAAACCGTATTTCTCGAGAAATACGGTTTCAGCATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032725.3-975s21c1
Sequence:CCGGAGAACAGCAAATATGAGTATGCTCGAGCATACTCATATTTGCTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032725.3-1962s21c1
Sequence:CCGGACAGTTGTCTGTGCTAATAATCTCGAGATTATTAGCACAGACAACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032725.3-679s21c1
Sequence:CCGGTAGGAGAGTCCGTCATGATTCCTCGAGGAATCATGACGGACTCTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032725.3-1879s21c1
Sequence:CCGGTGTTGAGGATATGTAACTTTCCTCGAGGAAAGTTACATATCCTCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146000
VALIDATED
BUD13 MISSION shRNA Bacterial Glycerol Stock
BUD13 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146000.1-1788s1c1
Sequence:CCGGCCTCCCAATAGATTCAACATTCTCGAGAATGTTGAATCTATTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146000.1-912s1c1
Sequence:CCGGCCTGATTTGGAACTGCACAAACTCGAGTTTGTGCAGTTCCAAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146000.1-739s1c1
Sequence:CCGGCCAGGAAGTCTCATCGTAATTCTCGAGAATTACGATGAGACTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146000.1-1641s1c1
Sequence:CCGGGCCCGCTACATAGATGATGAACTCGAGTTCATCATCTATGTAGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146000.1-2011s1c1
Sequence:CCGGGCTCTAAAGGAGTCCTGCTAACTCGAGTTAGCAGGACTCCTTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287517    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146000.2-2010s21c1
Sequence:CCGGGCTCTAAAGGAGTCCTGCTAACTCGAGTTAGCAGGACTCCTTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146000.2-738s21c1
Sequence:CCGGCCAGGAAGTCTCATCGTAATTCTCGAGAATTACGATGAGACTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146000.2-1063s21c1
Sequence:CCGGACGGCAAGCAAAGGCTCATTTCTCGAGAAATGAGCCTTTGCTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146000.2-1535s21c1
Sequence:CCGGTCAGAGCGAGATGAGCTATATCTCGAGATATAGCTCATCTCGCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146000
VALIDATED
BUD13 MISSION shRNA shRNA Plasmid DNA
BUD13 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146000.1-1788s1c1
Sequence:CCGGCCTCCCAATAGATTCAACATTCTCGAGAATGTTGAATCTATTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146000.1-912s1c1
Sequence:CCGGCCTGATTTGGAACTGCACAAACTCGAGTTTGTGCAGTTCCAAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146000.1-739s1c1
Sequence:CCGGCCAGGAAGTCTCATCGTAATTCTCGAGAATTACGATGAGACTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146000.1-1641s1c1
Sequence:CCGGGCCCGCTACATAGATGATGAACTCGAGTTCATCATCTATGTAGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146000.1-2011s1c1
Sequence:CCGGGCTCTAAAGGAGTCCTGCTAACTCGAGTTAGCAGGACTCCTTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287517    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146000.2-2010s21c1
Sequence:CCGGGCTCTAAAGGAGTCCTGCTAACTCGAGTTAGCAGGACTCCTTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146000.2-738s21c1
Sequence:CCGGCCAGGAAGTCTCATCGTAATTCTCGAGAATTACGATGAGACTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146000.2-1063s21c1
Sequence:CCGGACGGCAAGCAAAGGCTCATTTCTCGAGAAATGAGCCTTTGCTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146000.2-1535s21c1
Sequence:CCGGTCAGAGCGAGATGAGCTATATCTCGAGATATAGCTCATCTCGCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146000
VALIDATED
BUD13 MISSION shRNA Lentiviral Transduction Particles
BUD13 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146000.1-1788s1c1
Sequence:CCGGCCTCCCAATAGATTCAACATTCTCGAGAATGTTGAATCTATTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146000.1-912s1c1
Sequence:CCGGCCTGATTTGGAACTGCACAAACTCGAGTTTGTGCAGTTCCAAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146000.1-739s1c1
Sequence:CCGGCCAGGAAGTCTCATCGTAATTCTCGAGAATTACGATGAGACTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146000.1-1641s1c1
Sequence:CCGGGCCCGCTACATAGATGATGAACTCGAGTTCATCATCTATGTAGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146000.1-2011s1c1
Sequence:CCGGGCTCTAAAGGAGTCCTGCTAACTCGAGTTAGCAGGACTCCTTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287517    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146000.2-2010s21c1
Sequence:CCGGGCTCTAAAGGAGTCCTGCTAACTCGAGTTAGCAGGACTCCTTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146000.2-738s21c1
Sequence:CCGGCCAGGAAGTCTCATCGTAATTCTCGAGAATTACGATGAGACTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146000.2-1063s21c1
Sequence:CCGGACGGCAAGCAAAGGCTCATTTCTCGAGAAATGAGCCTTTGCTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146000.2-1535s21c1
Sequence:CCGGTCAGAGCGAGATGAGCTATATCTCGAGATATAGCTCATCTCGCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks