EMAIL THIS PAGE TO A FRIEND

BUD31

BUD31 homolog (S. cerevisiae)

100 Gene Product Result for
Synonyms: Cwc14 EDG-2 EDG2 G10 YCR063W fSAP17
UniProtKB ID: P41223, A4D274, D6W5S6, Q6IB53, Q9UDV1
Gene ID:
Mouse(231889) BUD31 homolog (yeast)
Rat(89819) BUD31 homolog (S. cerevisiae)
Zebrafish(445383) BUD31 homolog (yeast)
dog(479743) BUD31 homolog (S. cerevisiae)
cow(533977) BUD31 homolog (S. cerevisiae)
domestic cat(101085168) BUD31 homolog (S. cerevisiae)
chicken(416492) BUD31 homolog (S. cerevisiae)
naked mole-rat(101700237) BUD31 homolog (S. cerevisiae)
domestic guinea pig(100722723) BUD31 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1409960 Anti-BUD31 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
AV38402 Anti-BUD31 antibody produced in rabbit IgG fraction of antiserum mouse, zebrafish, rat, human, canine, rabbit, guinea pig, horse, Caenorhabditis elegans,
western blot pricing
SAB2100233 Anti-BUD31 antibody produced in rabbit affinity isolated antibody Caenorhabditis elegans, mouse, rabbit, guinea pig, bovine, human, horse, canine, rat
western blot pricing
HPA028943 Anti-BUD31 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB4503497 Anti-BUD31, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
WH0008896M10 Monoclonal Anti-G10 antibody produced in mouse clone 1E10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003910 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003910 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003910 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001008705 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001008705 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001008705 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003910 Rosetta Predictions human pricing
NM_053556 Rosetta Predictions rat pricing
NM_001008705 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003910 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336542 predicted 596
2 SASI_Hs01_00117748 predicted 643
3 SASI_Hs01_00117749 predicted 630
4 SASI_Hs02_00336543 predicted 604
5 SASI_Hs02_00336544 predicted 814
6 SASI_Hs01_00117752 predicted 645
7 SASI_Hs01_00117753 predicted 764
8 SASI_Hs02_00336545 predicted 598
9 SASI_Hs02_00336546 predicted 813
10 SASI_Hs01_00117754 predicted 760
11 SASI_Hs01_00117750 predicted 637
12 SASI_Hs01_00117751 predicted 773
13 SASI_Hs01_00117755 predicted 800
14 SASI_Hs01_00117756 predicted 806
15 SASI_Hs01_00117757 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053556 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114339 predicted 456
2 SASI_Rn01_00114341 predicted 195
3 SASI_Rn01_00114342 predicted 468
4 SASI_Rn01_00114343 predicted 354
5 SASI_Rn01_00114344 predicted 354
6 SASI_Rn01_00114345 predicted 347
7 SASI_Rn01_00114346 predicted 399
8 SASI_Rn01_00114347 predicted 309
9 SASI_Rn01_00114348 predicted 550
10 SASI_Rn02_00266213 predicted 456
11 SASI_Rn01_00114340 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008705 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286842 predicted 427
2 SASI_Mm01_00167640 predicted 378
3 SASI_Mm02_00286843 predicted 428
4 SASI_Mm01_00167641 predicted 358
5 SASI_Mm01_00167642 predicted 407
6 SASI_Mm01_00167643 predicted 450
7 SASI_Mm01_00167644 predicted 462
8 SASI_Mm01_00167645 predicted 410
9 SASI_Mm01_00167646 predicted 410
10 SASI_Mm01_00167647 predicted 409
11 SASI_Mm01_00167648 predicted 377
12 SASI_Mm01_00167649 predicted 382
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003910
VALIDATED
BUD31 MISSION shRNA Bacterial Glycerol Stock
BUD31 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003910.3-645s21c1
Sequence:CCGGGCAGAGAACTCTATGAATATTCTCGAGAATATTCATAGAGTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003910.3-605s21c1
Sequence:CCGGCGCTACATCTTCGACCTCTTTCTCGAGAAAGAGGTCGAAGATGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003910.3-880s21c1
Sequence:CCGGTCCACCCTGGACTCTGGACTTCTCGAGAAGTCCAGAGTCCAGGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003910.3-495s21c1
Sequence:CCGGCACTGGATGAATTAGATCAAACTCGAGTTTGATCTAATTCATCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003910.3-524s21c1
Sequence:CCGGGAAGCTGAAACAGAACCGCATCTCGAGATGCGGTTCTGTTTCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003910.2-869s1c1
Sequence:CCGGTCCACCCTGGACTCTGGACTTCTCGAGAAGTCCAGAGTCCAGGGTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003910.2-513s1c1
Sequence:CCGGGAAGCTGAAACAGAACCGCATCTCGAGATGCGGTTCTGTTTCAGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003910.2-594s1c1
Sequence:CCGGCGCTACATCTTCGACCTCTTTCTCGAGAAAGAGGTCGAAGATGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003910.2-634s1c1
Sequence:CCGGGCAGAGAACTCTATGAATATTCTCGAGAATATTCATAGAGTTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003910.2-484s1c1
Sequence:CCGGCACTGGATGAATTAGATCAAACTCGAGTTTGATCTAATTCATCCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003910
VALIDATED
BUD31 MISSION shRNA shRNA Plasmid DNA
BUD31 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003910.3-645s21c1
Sequence:CCGGGCAGAGAACTCTATGAATATTCTCGAGAATATTCATAGAGTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003910.3-605s21c1
Sequence:CCGGCGCTACATCTTCGACCTCTTTCTCGAGAAAGAGGTCGAAGATGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003910.3-880s21c1
Sequence:CCGGTCCACCCTGGACTCTGGACTTCTCGAGAAGTCCAGAGTCCAGGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003910.3-495s21c1
Sequence:CCGGCACTGGATGAATTAGATCAAACTCGAGTTTGATCTAATTCATCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003910.3-524s21c1
Sequence:CCGGGAAGCTGAAACAGAACCGCATCTCGAGATGCGGTTCTGTTTCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003910.2-869s1c1
Sequence:CCGGTCCACCCTGGACTCTGGACTTCTCGAGAAGTCCAGAGTCCAGGGTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003910.2-513s1c1
Sequence:CCGGGAAGCTGAAACAGAACCGCATCTCGAGATGCGGTTCTGTTTCAGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003910.2-594s1c1
Sequence:CCGGCGCTACATCTTCGACCTCTTTCTCGAGAAAGAGGTCGAAGATGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003910.2-634s1c1
Sequence:CCGGGCAGAGAACTCTATGAATATTCTCGAGAATATTCATAGAGTTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003910.2-484s1c1
Sequence:CCGGCACTGGATGAATTAGATCAAACTCGAGTTTGATCTAATTCATCCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003910
VALIDATED
BUD31 MISSION shRNA Lentiviral Transduction Particles
BUD31 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003910.3-645s21c1
Sequence:CCGGGCAGAGAACTCTATGAATATTCTCGAGAATATTCATAGAGTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003910.3-605s21c1
Sequence:CCGGCGCTACATCTTCGACCTCTTTCTCGAGAAAGAGGTCGAAGATGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003910.3-880s21c1
Sequence:CCGGTCCACCCTGGACTCTGGACTTCTCGAGAAGTCCAGAGTCCAGGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003910.3-495s21c1
Sequence:CCGGCACTGGATGAATTAGATCAAACTCGAGTTTGATCTAATTCATCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003910.3-524s21c1
Sequence:CCGGGAAGCTGAAACAGAACCGCATCTCGAGATGCGGTTCTGTTTCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003910.2-869s1c1
Sequence:CCGGTCCACCCTGGACTCTGGACTTCTCGAGAAGTCCAGAGTCCAGGGTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003910.2-513s1c1
Sequence:CCGGGAAGCTGAAACAGAACCGCATCTCGAGATGCGGTTCTGTTTCAGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003910.2-594s1c1
Sequence:CCGGCGCTACATCTTCGACCTCTTTCTCGAGAAAGAGGTCGAAGATGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003910.2-634s1c1
Sequence:CCGGGCAGAGAACTCTATGAATATTCTCGAGAATATTCATAGAGTTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003910.2-484s1c1
Sequence:CCGGCACTGGATGAATTAGATCAAACTCGAGTTTGATCTAATTCATCCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008705
VALIDATED
BUD31 MISSION shRNA Bacterial Glycerol Stock
BUD31 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008705.1-266s21c1
Sequence:CCGGCGTTGGATGAACTAGATCAAACTCGAGTTTGATCTAGTTCATCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008705.1-539s21c1
Sequence:CCGGTGGTCTTTGGACCTTGGACTTCTCGAGAAGTCCAAGGTCCAAAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008705.1-245s21c1
Sequence:CCGGGCTGGGAGTTGATTGAACCAACTCGAGTTGGTTCAATCAACTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008705.1-298s21c1
Sequence:CCGGGAACTCTATGAATACTGCATTCTCGAGAATGCAGTATTCATAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113545    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001008705.1-539s1c1
Sequence:CCGGTGGTCTTTGGACCTTGGACTTCTCGAGAAGTCCAAGGTCCAAAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008705.1-424s1c1
Sequence:CCGGACCAACTGCATTTGCCGGGTTCTCGAGAACCCGGCAAATGCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001008705.1-245s1c1
Sequence:CCGGGCTGGGAGTTGATTGAACCAACTCGAGTTGGTTCAATCAACTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001008705.1-266s1c1
Sequence:CCGGCGTTGGATGAACTAGATCAAACTCGAGTTTGATCTAGTTCATCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001008705.1-298s1c1
Sequence:CCGGGAACTCTATGAATACTGCATTCTCGAGAATGCAGTATTCATAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008705
VALIDATED
BUD31 MISSION shRNA shRNA Plasmid DNA
BUD31 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008705.1-266s21c1
Sequence:CCGGCGTTGGATGAACTAGATCAAACTCGAGTTTGATCTAGTTCATCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008705.1-539s21c1
Sequence:CCGGTGGTCTTTGGACCTTGGACTTCTCGAGAAGTCCAAGGTCCAAAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008705.1-245s21c1
Sequence:CCGGGCTGGGAGTTGATTGAACCAACTCGAGTTGGTTCAATCAACTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008705.1-298s21c1
Sequence:CCGGGAACTCTATGAATACTGCATTCTCGAGAATGCAGTATTCATAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113545    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001008705.1-539s1c1
Sequence:CCGGTGGTCTTTGGACCTTGGACTTCTCGAGAAGTCCAAGGTCCAAAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008705.1-424s1c1
Sequence:CCGGACCAACTGCATTTGCCGGGTTCTCGAGAACCCGGCAAATGCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001008705.1-245s1c1
Sequence:CCGGGCTGGGAGTTGATTGAACCAACTCGAGTTGGTTCAATCAACTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001008705.1-266s1c1
Sequence:CCGGCGTTGGATGAACTAGATCAAACTCGAGTTTGATCTAGTTCATCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001008705.1-298s1c1
Sequence:CCGGGAACTCTATGAATACTGCATTCTCGAGAATGCAGTATTCATAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008705
VALIDATED
BUD31 MISSION shRNA Lentiviral Transduction Particles
BUD31 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008705.1-266s21c1
Sequence:CCGGCGTTGGATGAACTAGATCAAACTCGAGTTTGATCTAGTTCATCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008705.1-539s21c1
Sequence:CCGGTGGTCTTTGGACCTTGGACTTCTCGAGAAGTCCAAGGTCCAAAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008705.1-245s21c1
Sequence:CCGGGCTGGGAGTTGATTGAACCAACTCGAGTTGGTTCAATCAACTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008705.1-298s21c1
Sequence:CCGGGAACTCTATGAATACTGCATTCTCGAGAATGCAGTATTCATAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113545    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001008705.1-539s1c1
Sequence:CCGGTGGTCTTTGGACCTTGGACTTCTCGAGAAGTCCAAGGTCCAAAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008705.1-424s1c1
Sequence:CCGGACCAACTGCATTTGCCGGGTTCTCGAGAACCCGGCAAATGCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001008705.1-245s1c1
Sequence:CCGGGCTGGGAGTTGATTGAACCAACTCGAGTTGGTTCAATCAACTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001008705.1-266s1c1
Sequence:CCGGCGTTGGATGAACTAGATCAAACTCGAGTTTGATCTAGTTCATCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001008705.1-298s1c1
Sequence:CCGGGAACTCTATGAATACTGCATTCTCGAGAATGCAGTATTCATAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks