EMAIL THIS PAGE TO A FRIEND

BVES

blood vessel epicardial substance

193 Gene Product Result for
Synonyms: HBVES POP1 POPDC1
Gene ID:
Human(11149) Summary: This gene encodes a member of the POP family of proteins containing three putative transmembrane domains. This gene is expressed in cardiac and skeletal muscle and may play an important role in development of these tissues. The mouse ortholog may be involved in the regeneration of adult skeletal muscle and may act as a cell adhesion molecule in coronary vasculogenesis. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2010]
Mouse(23828) blood vessel epicardial substance
Rat(365603) blood vessel epicardial substance
domestic guinea pig(100726176) blood vessel epicardial substance
naked mole-rat(101719869) blood vessel epicardial substance
sheep(101121685) blood vessel epicardial substance
Domestic Rabbit(100346465) blood vessel epicardial substance
Zebrafish(415107) blood vessel epicardial substance
cow(539988) blood vessel epicardial substance
Horse(100066283) blood vessel epicardial substance
domestic cat(101091197) blood vessel epicardial substance
dog(481944) blood vessel epicardial substance
chicken(408032) blood vessel epicardial substance
fruit fly(33083) CG32513 gene product from transcript CG32513-RA
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007073 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007073 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007073 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024285 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024285 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024285 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007073 Rosetta Predictions human pricing
NM_147147 Rosetta Predictions human pricing
NM_001077590 Rosetta Predictions rat pricing
XM_345123 Rosetta Predictions rat pricing
NM_024285 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007073 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171819 predicted 558
2 SASI_Hs01_00171820 predicted 1133
3 SASI_Hs01_00171821 predicted 932
4 SASI_Hs01_00171822 predicted 799
5 SASI_Hs01_00171823 predicted 823
6 SASI_Hs01_00171824 predicted 372
7 SASI_Hs01_00171825 predicted 455
8 SASI_Hs01_00171826 predicted 809
9 SASI_Hs02_00342901 predicted 321
10 SASI_Hs01_00171827 predicted 458
11 SASI_Hs01_00171828 predicted 745
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147147 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048740 predicted 634
2 SASI_Hs01_00048741 predicted 1208
3 SASI_Hs01_00048742 predicted 1004
4 SASI_Hs01_00048743 predicted 865
5 SASI_Hs01_00048744 predicted 886
6 SASI_Hs01_00048745 predicted 440
7 SASI_Hs01_00048746 predicted 529
8 SASI_Hs01_00048747 predicted 874
9 SASI_Hs02_00365484 predicted 387
10 SASI_Hs01_00048748 predicted 532
11 SASI_Hs01_00048749 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077590 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207602 predicted 590
2 SASI_Rn02_00207603 predicted 662
3 SASI_Rn02_00207604 predicted 1143
4 SASI_Rn02_00207605 predicted 432
5 SASI_Rn02_00207606 predicted 615
6 SASI_Rn02_00207607 predicted 527
7 SASI_Rn02_00207608 predicted 517
8 SASI_Rn02_00207609 predicted 490
9 SASI_Rn02_00207610 predicted 764
10 SASI_Rn02_00207611 predicted 1142
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345123 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00179604 predicted 250
2 SASI_Rn01_00179605 predicted 141
3 SASI_Rn01_00179606 predicted 69
4 SASI_Rn01_00179607 predicted 160
5 SASI_Rn01_00179608 predicted 225
6 SASI_Rn01_00179609 predicted 159
7 SASI_Rn01_00179610 predicted 69
8 SASI_Rn01_00179611 predicted 309
9 SASI_Rn01_00179612 predicted 253
10 SASI_Rn01_00179613 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024285 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182771 predicted 304
2 SASI_Mm01_00182772 predicted 832
3 SASI_Mm01_00182773 predicted 918
4 SASI_Mm01_00182774 predicted 826
5 SASI_Mm01_00182775 predicted 914
6 SASI_Mm01_00182776 predicted 808
7 SASI_Mm01_00182777 predicted 642
8 SASI_Mm01_00182778 predicted 336
9 SASI_Mm02_00327712 predicted 772
10 SASI_Mm01_00182779 predicted 809
11 SASI_Mm01_00182780 predicted 337
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007073
VALIDATED
BVES MISSION shRNA Bacterial Glycerol Stock
blood vessel epicardial substance
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007073.2-263s1c1
Sequence:CCGGCCAACTACTCTTCACCTTCATCTCGAGATGAAGGTGAAGAGTAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007073.2-117s1c1
Sequence:CCGGGAGAATCAACTGCCATAGGTTCTCGAGAACCTATGGCAGTTGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007073.2-201s1c1
Sequence:CCGGGAGAGATACATCATCTGGTTTCTCGAGAAACCAGATGATGTATCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151809    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007073.2-799s1c1
Sequence:CCGGCTTTCTGGAATCAGAACCTTTCTCGAGAAAGGTTCTGATTCCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007073.2-955s1c1
Sequence:CCGGGTTGGAAATGAGGAACAGTATCTCGAGATACTGTTCCTCATTTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007073.2-1104s1c1
Sequence:CCGGCAGAAGATGATGATGACGTTTCTCGAGAAACGTCATCATCATCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007073.2-503s1c1
Sequence:CCGGCCAGATTTGTTCAGAAGACTACTCGAGTAGTCTTCTGAACAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007073.2-514s1c1
Sequence:CCGGCAGAAGACTAACTGGACAGTTCTCGAGAACTGTCCAGTTAGTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007073.3-383s21c1
Sequence:CCGGTGTTCTTGGGTGTCAACATTTCTCGAGAAATGTTGACACCCAAGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007073.3-1617s21c1
Sequence:CCGGAGCAGGGAATCTCAAACTTTACTCGAGTAAAGTTTGAGATTCCCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007073.3-347s21c1
Sequence:CCGGACCGATGTGCCTTGGATATAACTCGAGTTATATCCAAGGCACATCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007073
VALIDATED
BVES MISSION shRNA shRNA Plasmid DNA
blood vessel epicardial substance
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007073.2-263s1c1
Sequence:CCGGCCAACTACTCTTCACCTTCATCTCGAGATGAAGGTGAAGAGTAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007073.2-117s1c1
Sequence:CCGGGAGAATCAACTGCCATAGGTTCTCGAGAACCTATGGCAGTTGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007073.2-201s1c1
Sequence:CCGGGAGAGATACATCATCTGGTTTCTCGAGAAACCAGATGATGTATCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151809    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007073.2-799s1c1
Sequence:CCGGCTTTCTGGAATCAGAACCTTTCTCGAGAAAGGTTCTGATTCCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007073.2-955s1c1
Sequence:CCGGGTTGGAAATGAGGAACAGTATCTCGAGATACTGTTCCTCATTTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007073.2-1104s1c1
Sequence:CCGGCAGAAGATGATGATGACGTTTCTCGAGAAACGTCATCATCATCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007073.2-503s1c1
Sequence:CCGGCCAGATTTGTTCAGAAGACTACTCGAGTAGTCTTCTGAACAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007073.2-514s1c1
Sequence:CCGGCAGAAGACTAACTGGACAGTTCTCGAGAACTGTCCAGTTAGTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007073.3-383s21c1
Sequence:CCGGTGTTCTTGGGTGTCAACATTTCTCGAGAAATGTTGACACCCAAGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007073.3-1617s21c1
Sequence:CCGGAGCAGGGAATCTCAAACTTTACTCGAGTAAAGTTTGAGATTCCCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007073.3-347s21c1
Sequence:CCGGACCGATGTGCCTTGGATATAACTCGAGTTATATCCAAGGCACATCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007073
VALIDATED
BVES MISSION shRNA Lentiviral Transduction Particles
blood vessel epicardial substance
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007073.2-263s1c1
Sequence:CCGGCCAACTACTCTTCACCTTCATCTCGAGATGAAGGTGAAGAGTAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007073.2-117s1c1
Sequence:CCGGGAGAATCAACTGCCATAGGTTCTCGAGAACCTATGGCAGTTGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007073.2-201s1c1
Sequence:CCGGGAGAGATACATCATCTGGTTTCTCGAGAAACCAGATGATGTATCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151809    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007073.2-799s1c1
Sequence:CCGGCTTTCTGGAATCAGAACCTTTCTCGAGAAAGGTTCTGATTCCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007073.2-955s1c1
Sequence:CCGGGTTGGAAATGAGGAACAGTATCTCGAGATACTGTTCCTCATTTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007073.2-1104s1c1
Sequence:CCGGCAGAAGATGATGATGACGTTTCTCGAGAAACGTCATCATCATCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007073.2-503s1c1
Sequence:CCGGCCAGATTTGTTCAGAAGACTACTCGAGTAGTCTTCTGAACAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007073.2-514s1c1
Sequence:CCGGCAGAAGACTAACTGGACAGTTCTCGAGAACTGTCCAGTTAGTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007073.3-383s21c1
Sequence:CCGGTGTTCTTGGGTGTCAACATTTCTCGAGAAATGTTGACACCCAAGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007073.3-1617s21c1
Sequence:CCGGAGCAGGGAATCTCAAACTTTACTCGAGTAAAGTTTGAGATTCCCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007073.3-347s21c1
Sequence:CCGGACCGATGTGCCTTGGATATAACTCGAGTTATATCCAAGGCACATCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024285
BVES MISSION shRNA Bacterial Glycerol Stock
blood vessel epicardial substance
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024285.1-819s1c1
Sequence:CCGGGTCAAGAGAAAGACTGACTTACTCGAGTAAGTCAGTCTTTCTCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024285.1-782s1c1
Sequence:CCGGCCATTGTTGCAGATGATAACTCTCGAGAGTTATCATCTGCAACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024285.1-544s1c1
Sequence:CCGGCCGGATTTGTTTAGAAGGTTACTCGAGTAACCTTCTAAACAAATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024285.1-629s1c1
Sequence:CCGGCCTCAGTTGATGATCGTCTTACTCGAGTAAGACGATCATCAACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024285.1-1448s1c1
Sequence:CCGGGCTATCAACACAAACACCTTTCTCGAGAAAGGTGTTTGTGTTGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024285.2-745s21c1
Sequence:CCGGGATCAACGCAGATGCACAAAGCTCGAGCTTTGTGCATCTGCGTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024285.2-508s21c1
Sequence:CCGGGTGTCTACCATCGGTTGTTTGCTCGAGCAAACAACCGATGGTAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024285.2-424s1c1
Sequence:CCGGCGGTGTTCTTGGGTATCAATACTCGAGTATTGATACCCAAGAACACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024285.2-232s21c1
Sequence:CCGGGTGAGAACTGGCGAGAGATTCCTCGAGGAATCTCTCGCCAGTTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024285.2-351s21c1
Sequence:CCGGTCTCTAGGATGTACCCTTTATCTCGAGATAAAGGGTACATCCTAGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024285
BVES MISSION shRNA shRNA Plasmid DNA
blood vessel epicardial substance
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024285.1-819s1c1
Sequence:CCGGGTCAAGAGAAAGACTGACTTACTCGAGTAAGTCAGTCTTTCTCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024285.1-782s1c1
Sequence:CCGGCCATTGTTGCAGATGATAACTCTCGAGAGTTATCATCTGCAACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024285.1-544s1c1
Sequence:CCGGCCGGATTTGTTTAGAAGGTTACTCGAGTAACCTTCTAAACAAATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024285.1-629s1c1
Sequence:CCGGCCTCAGTTGATGATCGTCTTACTCGAGTAAGACGATCATCAACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024285.1-1448s1c1
Sequence:CCGGGCTATCAACACAAACACCTTTCTCGAGAAAGGTGTTTGTGTTGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024285.2-745s21c1
Sequence:CCGGGATCAACGCAGATGCACAAAGCTCGAGCTTTGTGCATCTGCGTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024285.2-508s21c1
Sequence:CCGGGTGTCTACCATCGGTTGTTTGCTCGAGCAAACAACCGATGGTAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024285.2-424s1c1
Sequence:CCGGCGGTGTTCTTGGGTATCAATACTCGAGTATTGATACCCAAGAACACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024285.2-232s21c1
Sequence:CCGGGTGAGAACTGGCGAGAGATTCCTCGAGGAATCTCTCGCCAGTTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024285.2-351s21c1
Sequence:CCGGTCTCTAGGATGTACCCTTTATCTCGAGATAAAGGGTACATCCTAGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024285
BVES MISSION shRNA Lentiviral Transduction Particles
blood vessel epicardial substance
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024285.1-819s1c1
Sequence:CCGGGTCAAGAGAAAGACTGACTTACTCGAGTAAGTCAGTCTTTCTCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024285.1-782s1c1
Sequence:CCGGCCATTGTTGCAGATGATAACTCTCGAGAGTTATCATCTGCAACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024285.1-544s1c1
Sequence:CCGGCCGGATTTGTTTAGAAGGTTACTCGAGTAACCTTCTAAACAAATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024285.1-629s1c1
Sequence:CCGGCCTCAGTTGATGATCGTCTTACTCGAGTAAGACGATCATCAACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024285.1-1448s1c1
Sequence:CCGGGCTATCAACACAAACACCTTTCTCGAGAAAGGTGTTTGTGTTGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024285.2-745s21c1
Sequence:CCGGGATCAACGCAGATGCACAAAGCTCGAGCTTTGTGCATCTGCGTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024285.2-508s21c1
Sequence:CCGGGTGTCTACCATCGGTTGTTTGCTCGAGCAAACAACCGATGGTAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024285.2-424s1c1
Sequence:CCGGCGGTGTTCTTGGGTATCAATACTCGAGTATTGATACCCAAGAACACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024285.2-232s21c1
Sequence:CCGGGTGAGAACTGGCGAGAGATTCCTCGAGGAATCTCTCGCCAGTTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024285.2-351s21c1
Sequence:CCGGTCTCTAGGATGTACCCTTTATCTCGAGATAAAGGGTACATCCTAGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks