EMAIL THIS PAGE TO A FRIEND

BZRAP1

benzodiazapine receptor (peripheral) associated protein 1

187 Gene Product Result for
Synonyms: PBR-IP PRAX-1 PRAX1 RIM-BP1 RIMBP1
UniProtKB ID: O95153, O75111, Q8N5W3
Gene ID:
Mouse(207777) benzodiazepine receptor associated protein 1
Rat(287609) benzodiazapine receptor (peripheral) associated protein 1
chicken(417469) benzodiazapine receptor (peripheral) associated protein 1
cow(518675) benzodiazapine receptor (peripheral) associated protein 1
dog(491112) benzodiazapine receptor (peripheral) associated protein 1
domestic cat(101097358) benzodiazapine receptor (peripheral) associated protein 1
Horse(100056918) benzodiazapine receptor (peripheral) associated protein 1
naked mole-rat(101708205) benzodiazapine receptor (peripheral) associated protein 1
domestic guinea pig(100719401) benzodiazapine receptor (peripheral) associated protein 1
sheep(101104839) benzodiazapine receptor (peripheral) associated protein 1
Domestic Rabbit(100355325) benzodiazapine receptor (peripheral) associated protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
E006 β-Carboline-3-carboxylic acid N-methylamide human pricing
Z4900 Zopiclone human pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
F6300 Flumazenil >99% (HPLC), solid human, rat pricing
C0424 PK 11195 human, rat pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
C4024 Carbamazepine powder human, rat pricing
C6862 CB 34 >98% (HPLC) human, rat pricing
D8555 N,N-Dihexyl-2-(4-fluorophenyl)indole-3-acetamide human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004758 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004758 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004758 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172449 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172449 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172449 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU160711 MISSION® esiRNA esiRNA human BZRAP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004758 Rosetta Predictions human pricing
NM_024418 Rosetta Predictions human pricing
XM_001081125 Rosetta Predictions rat pricing
XM_213427 Rosetta Predictions rat pricing
NM_172449 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004758 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031309 predicted 5838
2 SASI_Hs01_00031310 predicted 4377
3 SASI_Hs02_00338246 predicted 3666
4 SASI_Hs02_00338247 predicted 2712
5 SASI_Hs01_00031311 predicted 3924
6 SASI_Hs01_00031312 predicted 2334
7 SASI_Hs01_00031313 predicted 3585
8 SASI_Hs01_00031314 predicted 3879
9 SASI_Hs01_00031316 predicted 5731
10 SASI_Hs01_00031317 predicted 1022
11 SASI_Hs01_00031315 predicted 4679
12 SASI_Hs01_00031318 predicted 1994
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024418 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356721 predicted 5653
2 SASI_Hs02_00356722 predicted 4198
3 SASI_Hs02_00356723 predicted 3481
4 SASI_Hs02_00356724 predicted 2533
5 SASI_Hs02_00356725 predicted 3747
6 SASI_Hs02_00356726 predicted 2153
7 SASI_Hs02_00356727 predicted 3404
8 SASI_Hs02_00356728 predicted 3700
9 SASI_Hs02_00356729 predicted 5549
10 SASI_Hs02_00356730 predicted 1017
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081125 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370655 predicted 4825
2 SASI_Rn02_00370656 predicted 313
3 SASI_Rn02_00370657 predicted 593
4 SASI_Rn02_00370658 predicted 1775
5 SASI_Rn02_00370659 predicted 4876
6 SASI_Rn02_00370660 predicted 2177
7 SASI_Rn02_00370661 predicted 4441
8 SASI_Rn02_00370662 predicted 1456
9 SASI_Rn02_00370663 predicted 2437
10 SASI_Rn02_00370664 predicted 4868
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213427 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374603 predicted 2793
2 SASI_Rn02_00374604 predicted 2414
3 SASI_Rn02_00374605 predicted 2178
4 SASI_Rn02_00374606 predicted 2759
5 SASI_Rn02_00374607 predicted 2196
6 SASI_Rn02_00374608 predicted 2417
7 SASI_Rn02_00374609 predicted 2440
8 SASI_Rn02_00374610 predicted 1583
9 SASI_Rn02_00374611 predicted 2662
10 SASI_Rn02_00374612 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172449 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343959 predicted 6397
2 SASI_Mm02_00343960 predicted 3899
3 SASI_Mm02_00343961 predicted 1449
4 SASI_Mm02_00343962 predicted 2638
5 SASI_Mm02_00343963 predicted 3626
6 SASI_Mm02_00343964 predicted 1008
7 SASI_Mm02_00343965 predicted 2892
8 SASI_Mm02_00343966 predicted 2315
9 SASI_Mm01_00142083 predicted 6241
10 SASI_Mm02_00343967 predicted 5743
11 SASI_Mm01_00142079 predicted 2926
12 SASI_Mm01_00142080 predicted 2946
13 SASI_Mm01_00142081 predicted 2644
14 SASI_Mm01_00142082 predicted 2687
15 SASI_Mm01_00142084 predicted 2842
16 SASI_Mm01_00142085 predicted 2131
17 SASI_Mm01_00142086 predicted 2174
18 SASI_Mm01_00142087 predicted 2083
19 SASI_Mm01_00142088 predicted 2081
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004758
BZRAP1 MISSION shRNA Bacterial Glycerol Stock
benzodiazapine receptor (peripheral) associated protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004758.1-4678s1c1
Sequence:CCGGGCTTGGAAATCAGCATTGAATCTCGAGATTCAATGCTGATTTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004758.1-4160s1c1
Sequence:CCGGCCAGCAGTTCTGTAGCAAGAACTCGAGTTCTTGCTACAGAACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004758.1-2171s1c1
Sequence:CCGGCCTAGCACGTTATAGCTACAACTCGAGTTGTAGCTATAACGTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004758.1-2660s1c1
Sequence:CCGGCGGCTTCCATATCTGTGTGAACTCGAGTTCACACAGATATGGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004758.1-5109s1c1
Sequence:CCGGCCCGTGTCAATGTCGCCCAATCTCGAGATTGGGCGACATTGACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004758.2-1983s21c1
Sequence:CCGGAGCTGAGACAAGCGCAGAATGCTCGAGCATTCTGCGCTTGTCTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004758.2-5157s21c1
Sequence:CCGGGCCGACTTCTCAGCAACAATGCTCGAGCATTGTTGCTGAGAAGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004758.2-6803s21c1
Sequence:CCGGGGTGAAGGTCAGAGCTAAATGCTCGAGCATTTAGCTCTGACCTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004758.2-6285s21c1
Sequence:CCGGACGATGACGGTTTCTACTATGCTCGAGCATAGTAGAAACCGTCATCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004758
BZRAP1 MISSION shRNA shRNA Plasmid DNA
benzodiazapine receptor (peripheral) associated protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004758.1-4678s1c1
Sequence:CCGGGCTTGGAAATCAGCATTGAATCTCGAGATTCAATGCTGATTTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004758.1-4160s1c1
Sequence:CCGGCCAGCAGTTCTGTAGCAAGAACTCGAGTTCTTGCTACAGAACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004758.1-2171s1c1
Sequence:CCGGCCTAGCACGTTATAGCTACAACTCGAGTTGTAGCTATAACGTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004758.1-2660s1c1
Sequence:CCGGCGGCTTCCATATCTGTGTGAACTCGAGTTCACACAGATATGGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004758.1-5109s1c1
Sequence:CCGGCCCGTGTCAATGTCGCCCAATCTCGAGATTGGGCGACATTGACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004758.2-1983s21c1
Sequence:CCGGAGCTGAGACAAGCGCAGAATGCTCGAGCATTCTGCGCTTGTCTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004758.2-5157s21c1
Sequence:CCGGGCCGACTTCTCAGCAACAATGCTCGAGCATTGTTGCTGAGAAGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004758.2-6803s21c1
Sequence:CCGGGGTGAAGGTCAGAGCTAAATGCTCGAGCATTTAGCTCTGACCTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004758.2-6285s21c1
Sequence:CCGGACGATGACGGTTTCTACTATGCTCGAGCATAGTAGAAACCGTCATCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004758
BZRAP1 MISSION shRNA Lentiviral Transduction Particles
benzodiazapine receptor (peripheral) associated protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004758.1-4678s1c1
Sequence:CCGGGCTTGGAAATCAGCATTGAATCTCGAGATTCAATGCTGATTTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004758.1-4160s1c1
Sequence:CCGGCCAGCAGTTCTGTAGCAAGAACTCGAGTTCTTGCTACAGAACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004758.1-2171s1c1
Sequence:CCGGCCTAGCACGTTATAGCTACAACTCGAGTTGTAGCTATAACGTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004758.1-2660s1c1
Sequence:CCGGCGGCTTCCATATCTGTGTGAACTCGAGTTCACACAGATATGGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004758.1-5109s1c1
Sequence:CCGGCCCGTGTCAATGTCGCCCAATCTCGAGATTGGGCGACATTGACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004758.2-1983s21c1
Sequence:CCGGAGCTGAGACAAGCGCAGAATGCTCGAGCATTCTGCGCTTGTCTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004758.2-5157s21c1
Sequence:CCGGGCCGACTTCTCAGCAACAATGCTCGAGCATTGTTGCTGAGAAGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004758.2-6803s21c1
Sequence:CCGGGGTGAAGGTCAGAGCTAAATGCTCGAGCATTTAGCTCTGACCTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004758.2-6285s21c1
Sequence:CCGGACGATGACGGTTTCTACTATGCTCGAGCATAGTAGAAACCGTCATCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172449
BZRAP1 MISSION shRNA Bacterial Glycerol Stock
benzodiazapine receptor (peripheral) associated protein 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172449.1-2244s1c1
Sequence:CCGGGTTCCATCCAACTTCCTGGAACTCGAGTTCCAGGAAGTTGGATGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172449.1-1755s1c1
Sequence:CCGGCAACTCCTCAAGGTGTTTGGACTCGAGTCCAAACACCTTGAGGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172449.2-4466s21c1
Sequence:CCGGCCCAGAAGAAGCCAAGTATTGCTCGAGCAATACTTGGCTTCTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172449.2-7361s21c1
Sequence:CCGGTGAGGGAAAGGACGGATTTATCTCGAGATAAATCCGTCCTTTCCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172449.2-6142s21c1
Sequence:CCGGGTGGCTGCATTTGACTATAATCTCGAGATTATAGTCAAATGCAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172449.2-4009s21c1
Sequence:CCGGGAGGTGACTGTACGCACTATGCTCGAGCATAGTGCGTACAGTCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172449
BZRAP1 MISSION shRNA shRNA Plasmid DNA
benzodiazapine receptor (peripheral) associated protein 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172449.1-2244s1c1
Sequence:CCGGGTTCCATCCAACTTCCTGGAACTCGAGTTCCAGGAAGTTGGATGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172449.1-1755s1c1
Sequence:CCGGCAACTCCTCAAGGTGTTTGGACTCGAGTCCAAACACCTTGAGGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172449.2-4466s21c1
Sequence:CCGGCCCAGAAGAAGCCAAGTATTGCTCGAGCAATACTTGGCTTCTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172449.2-7361s21c1
Sequence:CCGGTGAGGGAAAGGACGGATTTATCTCGAGATAAATCCGTCCTTTCCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172449.2-6142s21c1
Sequence:CCGGGTGGCTGCATTTGACTATAATCTCGAGATTATAGTCAAATGCAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172449.2-4009s21c1
Sequence:CCGGGAGGTGACTGTACGCACTATGCTCGAGCATAGTGCGTACAGTCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172449
BZRAP1 MISSION shRNA Lentiviral Transduction Particles
benzodiazapine receptor (peripheral) associated protein 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172449.1-2244s1c1
Sequence:CCGGGTTCCATCCAACTTCCTGGAACTCGAGTTCCAGGAAGTTGGATGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172449.1-1755s1c1
Sequence:CCGGCAACTCCTCAAGGTGTTTGGACTCGAGTCCAAACACCTTGAGGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172449.2-4466s21c1
Sequence:CCGGCCCAGAAGAAGCCAAGTATTGCTCGAGCAATACTTGGCTTCTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172449.2-7361s21c1
Sequence:CCGGTGAGGGAAAGGACGGATTTATCTCGAGATAAATCCGTCCTTTCCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172449.2-6142s21c1
Sequence:CCGGGTGGCTGCATTTGACTATAATCTCGAGATTATAGTCAAATGCAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172449.2-4009s21c1
Sequence:CCGGGAGGTGACTGTACGCACTATGCTCGAGCATAGTGCGTACAGTCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks