EMAIL THIS PAGE TO A FRIEND

BZW1

basic leucine zipper and W2 domains 1

166 Gene Product Result for
Synonyms: BZAP45 Nbla10236
UniProtKB ID: Q7L1Q6, B4DLZ8, B4DWF7, Q14281, Q15394, Q9BUY0
Gene ID:
Mouse(66882) basic leucine zipper and W2 domains 1
Rat(363232) basic leucine zipper and W2 domains 1
chicken(424073) basic leucine zipper and W2 domains 1
dog(478865) basic leucine zipper and W2 domains 1
domestic cat(101091960) basic leucine zipper and W2 domains 1
Horse(100067807) basic leucine zipper and W2 domains 1
cow(506562) basic leucine zipper and W2 domains 1
sheep(101105056) basic leucine zipper and W2 domains 1
domestic guinea pig(100713891) basic leucine zipper and W2 domains 1
naked mole-rat(101721501) basic leucine zipper and W2 domains 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0060 AQUA Peptide DINAVAASL[R] cow, dog, human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014670 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014670 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014670 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025824 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025824 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025824 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014670 Rosetta Predictions human pricing
NM_198789 Rosetta Predictions rat pricing
NM_025824 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014670 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130853 predicted 561
2 SASI_Hs01_00130854 predicted 398
3 SASI_Hs02_00346019 predicted 631
4 SASI_Hs02_00346020 predicted 434
5 SASI_Hs01_00130856 predicted 561
6 SASI_Hs01_00130857 predicted 258
7 SASI_Hs01_00130858 predicted 567
8 SASI_Hs02_00346021 predicted 200
9 SASI_Hs02_00346022 predicted 365
10 SASI_Hs01_00130860 predicted 416
11 SASI_Hs01_00130851 predicted 1162
12 SASI_Hs01_00130852 predicted 1161
13 SASI_Hs01_00130855 predicted 1169
14 SASI_Hs01_00130859 predicted 444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198789 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076753 predicted 1362
2 SASI_Rn01_00076754 predicted 537
3 SASI_Rn01_00076755 predicted 195
4 SASI_Rn01_00076756 predicted 209
5 SASI_Rn01_00076757 predicted 764
6 SASI_Rn01_00076758 predicted 1440
7 SASI_Rn01_00076759 predicted 774
8 SASI_Rn01_00076760 predicted 1447
9 SASI_Rn01_00076761 predicted 753
10 SASI_Rn02_00270068 predicted 813
11 SASI_Rn01_00076752 predicted 206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025824 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329083 predicted 587
2 SASI_Mm01_00128878 predicted 432
3 SASI_Mm01_00128879 predicted 574
4 SASI_Mm01_00128880 predicted 684
5 SASI_Mm02_00329084 predicted 573
6 SASI_Mm02_00329085 predicted 444
7 SASI_Mm01_00128885 predicted 595
8 SASI_Mm02_00329086 predicted 298
9 SASI_Mm02_00329087 predicted 433
10 SASI_Mm02_00329088 predicted 642
11 SASI_Mm01_00128876 predicted 1372
12 SASI_Mm01_00128877 predicted 1355
13 SASI_Mm01_00128881 predicted 1221
14 SASI_Mm01_00128882 predicted 1243
15 SASI_Mm01_00128883 predicted 534
16 SASI_Mm01_00128884 predicted 202
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014670
VALIDATED
BZW1 MISSION shRNA Bacterial Glycerol Stock
basic leucine zipper and W2 domains 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014670.2-363s21c1
Sequence:CCGGTGCGTGTTTGCAGCCCAAGAACTCGAGTTCTTGGGCTGCAAACACGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014670.2-198s21c1
Sequence:CCGGACTGAAACCGGTACTGATTTGCTCGAGCAAATCAGTACCGGTTTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014670.2-352s21c1
Sequence:CCGGGTACAGATGTCTGCGTGTTTGCTCGAGCAAACACGCAGACATCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014670.2-178s21c1
Sequence:CCGGACTGTATTATTCAAGGCTTAACTCGAGTTAAGCCTTGAATAATACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014670.2-326s21c1
Sequence:CCGGTGGTACACTGGCAGATGACATCTCGAGATGTCATCTGCCAGTGTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014670.2-257s21c1
Sequence:CCGGACTTGATTACCGTCGATATGCCTCGAGGCATATCGACGGTAATCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014670.2-166s21c1
Sequence:CCGGCTCAGTTTCAAGACTGTATTACTCGAGTAATACAGTCTTGAAACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014670.2-339s1c1
Sequence:CCGGGATGACATGATGCGTACAGATCTCGAGATCTGTACGCATCATGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014670.2-422s1c1
Sequence:CCGGCAAGTTAATCAGGCGCTACAACTCGAGTTGTAGCGCCTGATTAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014670.2-222s1c1
Sequence:CCGGGCAGTAGCTAAGTTTCTTGATCTCGAGATCAAGAAACTTAGCTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014670.2-276s1c1
Sequence:CCGGGCAGAAACACTCTTTGACATTCTCGAGAATGTCAAAGAGTGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014670.2-738s1c1
Sequence:CCGGGCCAATAAGCAAAGTGTTGAACTCGAGTTCAACACTTTGCTTATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014670.2-735s1c1
Sequence:CCGGCCTGCCAATAAGCAAAGTGTTCTCGAGAACACTTTGCTTATTGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014670
VALIDATED
BZW1 MISSION shRNA shRNA Plasmid DNA
basic leucine zipper and W2 domains 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014670.2-363s21c1
Sequence:CCGGTGCGTGTTTGCAGCCCAAGAACTCGAGTTCTTGGGCTGCAAACACGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014670.2-198s21c1
Sequence:CCGGACTGAAACCGGTACTGATTTGCTCGAGCAAATCAGTACCGGTTTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014670.2-352s21c1
Sequence:CCGGGTACAGATGTCTGCGTGTTTGCTCGAGCAAACACGCAGACATCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014670.2-178s21c1
Sequence:CCGGACTGTATTATTCAAGGCTTAACTCGAGTTAAGCCTTGAATAATACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014670.2-326s21c1
Sequence:CCGGTGGTACACTGGCAGATGACATCTCGAGATGTCATCTGCCAGTGTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014670.2-257s21c1
Sequence:CCGGACTTGATTACCGTCGATATGCCTCGAGGCATATCGACGGTAATCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014670.2-166s21c1
Sequence:CCGGCTCAGTTTCAAGACTGTATTACTCGAGTAATACAGTCTTGAAACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014670.2-339s1c1
Sequence:CCGGGATGACATGATGCGTACAGATCTCGAGATCTGTACGCATCATGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014670.2-422s1c1
Sequence:CCGGCAAGTTAATCAGGCGCTACAACTCGAGTTGTAGCGCCTGATTAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014670.2-222s1c1
Sequence:CCGGGCAGTAGCTAAGTTTCTTGATCTCGAGATCAAGAAACTTAGCTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014670.2-276s1c1
Sequence:CCGGGCAGAAACACTCTTTGACATTCTCGAGAATGTCAAAGAGTGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014670.2-738s1c1
Sequence:CCGGGCCAATAAGCAAAGTGTTGAACTCGAGTTCAACACTTTGCTTATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014670.2-735s1c1
Sequence:CCGGCCTGCCAATAAGCAAAGTGTTCTCGAGAACACTTTGCTTATTGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014670
VALIDATED
BZW1 MISSION shRNA Lentiviral Transduction Particles
basic leucine zipper and W2 domains 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014670.2-363s21c1
Sequence:CCGGTGCGTGTTTGCAGCCCAAGAACTCGAGTTCTTGGGCTGCAAACACGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014670.2-198s21c1
Sequence:CCGGACTGAAACCGGTACTGATTTGCTCGAGCAAATCAGTACCGGTTTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014670.2-352s21c1
Sequence:CCGGGTACAGATGTCTGCGTGTTTGCTCGAGCAAACACGCAGACATCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014670.2-178s21c1
Sequence:CCGGACTGTATTATTCAAGGCTTAACTCGAGTTAAGCCTTGAATAATACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014670.2-326s21c1
Sequence:CCGGTGGTACACTGGCAGATGACATCTCGAGATGTCATCTGCCAGTGTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014670.2-257s21c1
Sequence:CCGGACTTGATTACCGTCGATATGCCTCGAGGCATATCGACGGTAATCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014670.2-166s21c1
Sequence:CCGGCTCAGTTTCAAGACTGTATTACTCGAGTAATACAGTCTTGAAACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014670.2-339s1c1
Sequence:CCGGGATGACATGATGCGTACAGATCTCGAGATCTGTACGCATCATGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014670.2-422s1c1
Sequence:CCGGCAAGTTAATCAGGCGCTACAACTCGAGTTGTAGCGCCTGATTAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014670.2-222s1c1
Sequence:CCGGGCAGTAGCTAAGTTTCTTGATCTCGAGATCAAGAAACTTAGCTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014670.2-276s1c1
Sequence:CCGGGCAGAAACACTCTTTGACATTCTCGAGAATGTCAAAGAGTGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014670.2-738s1c1
Sequence:CCGGGCCAATAAGCAAAGTGTTGAACTCGAGTTCAACACTTTGCTTATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014670.2-735s1c1
Sequence:CCGGCCTGCCAATAAGCAAAGTGTTCTCGAGAACACTTTGCTTATTGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025824
VALIDATED
BZW1 MISSION shRNA Bacterial Glycerol Stock
basic leucine zipper and W2 domains 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000312065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025824.3-577s21c1
Sequence:CCGGCCTTAATGCATCCATTCTTAACTCGAGTTAAGAATGGATGCATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025824.3-1217s21c1
Sequence:CCGGCCCATTCTGAAGTGGTATAAACTCGAGTTTATACCACTTCAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025824.3-588s21c1
Sequence:CCGGCCATTCTTAACAGCCTTTATACTCGAGTATAAAGGCTGTTAAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025824.3-1441s21c1
Sequence:CCGGCCCTATATCAAGCATGATATACTCGAGTATATCATGCTTGATATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025824.3-959s21c1
Sequence:CCGGCCAGTGGTCATTGGGATAGTCCTCGAGGACTATCCCAATGACCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025824.3-757s21c1
Sequence:CCGGTAAACAAAGTGTTGAGCATTTCTCGAGAAATGCTCAACACTTTGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025824.2-1441s1c1
Sequence:CCGGCCCTATATCAAGCATGATATACTCGAGTATATCATGCTTGATATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025824.2-588s1c1
Sequence:CCGGCCATTCTTAACAGCCTTTATACTCGAGTATAAAGGCTGTTAAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025824.2-1217s1c1
Sequence:CCGGCCCATTCTGAAGTGGTATAAACTCGAGTTTATACCACTTCAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025824.2-577s1c1
Sequence:CCGGCCTTAATGCATCCATTCTTAACTCGAGTTAAGAATGGATGCATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025824.2-191s1c1
Sequence:CCGGGACTGTATTATTCAAGGCTTACTCGAGTAAGCCTTGAATAATACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025824
VALIDATED
BZW1 MISSION shRNA shRNA Plasmid DNA
basic leucine zipper and W2 domains 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000312065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025824.3-577s21c1
Sequence:CCGGCCTTAATGCATCCATTCTTAACTCGAGTTAAGAATGGATGCATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025824.3-1217s21c1
Sequence:CCGGCCCATTCTGAAGTGGTATAAACTCGAGTTTATACCACTTCAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025824.3-588s21c1
Sequence:CCGGCCATTCTTAACAGCCTTTATACTCGAGTATAAAGGCTGTTAAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025824.3-1441s21c1
Sequence:CCGGCCCTATATCAAGCATGATATACTCGAGTATATCATGCTTGATATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025824.3-959s21c1
Sequence:CCGGCCAGTGGTCATTGGGATAGTCCTCGAGGACTATCCCAATGACCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025824.3-757s21c1
Sequence:CCGGTAAACAAAGTGTTGAGCATTTCTCGAGAAATGCTCAACACTTTGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025824.2-1441s1c1
Sequence:CCGGCCCTATATCAAGCATGATATACTCGAGTATATCATGCTTGATATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025824.2-588s1c1
Sequence:CCGGCCATTCTTAACAGCCTTTATACTCGAGTATAAAGGCTGTTAAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025824.2-1217s1c1
Sequence:CCGGCCCATTCTGAAGTGGTATAAACTCGAGTTTATACCACTTCAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025824.2-577s1c1
Sequence:CCGGCCTTAATGCATCCATTCTTAACTCGAGTTAAGAATGGATGCATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025824.2-191s1c1
Sequence:CCGGGACTGTATTATTCAAGGCTTACTCGAGTAAGCCTTGAATAATACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025824
VALIDATED
BZW1 MISSION shRNA Lentiviral Transduction Particles
basic leucine zipper and W2 domains 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000312065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025824.3-577s21c1
Sequence:CCGGCCTTAATGCATCCATTCTTAACTCGAGTTAAGAATGGATGCATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025824.3-1217s21c1
Sequence:CCGGCCCATTCTGAAGTGGTATAAACTCGAGTTTATACCACTTCAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025824.3-588s21c1
Sequence:CCGGCCATTCTTAACAGCCTTTATACTCGAGTATAAAGGCTGTTAAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025824.3-1441s21c1
Sequence:CCGGCCCTATATCAAGCATGATATACTCGAGTATATCATGCTTGATATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025824.3-959s21c1
Sequence:CCGGCCAGTGGTCATTGGGATAGTCCTCGAGGACTATCCCAATGACCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025824.3-757s21c1
Sequence:CCGGTAAACAAAGTGTTGAGCATTTCTCGAGAAATGCTCAACACTTTGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025824.2-1441s1c1
Sequence:CCGGCCCTATATCAAGCATGATATACTCGAGTATATCATGCTTGATATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025824.2-588s1c1
Sequence:CCGGCCATTCTTAACAGCCTTTATACTCGAGTATAAAGGCTGTTAAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025824.2-1217s1c1
Sequence:CCGGCCCATTCTGAAGTGGTATAAACTCGAGTTTATACCACTTCAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025824.2-577s1c1
Sequence:CCGGCCTTAATGCATCCATTCTTAACTCGAGTTAAGAATGGATGCATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025824.2-191s1c1
Sequence:CCGGGACTGTATTATTCAAGGCTTACTCGAGTAAGCCTTGAATAATACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks