EMAIL THIS PAGE TO A FRIEND

BZW2

basic leucine zipper and W2 domains 2

107 Gene Product Result for
Synonyms: MST017 MSTP017
UniProtKB ID: Q9Y6E2, A4D123, Q3B779, Q9H3F7
Gene ID:
Mouse(66912) basic leucine zipper and W2 domains 2
Rat(171439) basic leucine zipper and W2 domains 2
Zebrafish(393892) basic leucine zipper and W2 domains 2
cow(326579) basic leucine zipper and W2 domains 2
Horse(100053031) basic leucine zipper and W2 domains 2
domestic cat(101084016) basic leucine zipper and W2 domains 2
dog(475250) basic leucine zipper and W2 domains 2
chicken(420594) basic leucine zipper and W2 domains 2
naked mole-rat(101710739) basic leucine zipper and W2 domains 2
domestic guinea pig(100713098) basic leucine zipper and W2 domains 2
sheep(101104821) basic leucine zipper and W2 domains 2
Domestic Rabbit(100338021) basic leucine zipper and W2 domains 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014038 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014038 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014038 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025840 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025840 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025840 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014038 Rosetta Predictions human pricing
NM_134402 Rosetta Predictions rat pricing
NM_025840 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014038 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072320 predicted 1194
2 SASI_Hs01_00072321 predicted 1281
3 SASI_Hs01_00072322 predicted 1267
4 SASI_Hs01_00072323 predicted 872
5 SASI_Hs01_00072324 predicted 1271
6 SASI_Hs01_00072325 predicted 491
7 SASI_Hs01_00072326 predicted 317
8 SASI_Hs01_00072327 predicted 1011
9 SASI_Hs01_00072328 predicted 1007
10 SASI_Hs02_00345029 predicted 1045
11 SASI_Hs01_00072329 predicted 520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134402 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101003 predicted 498
2 SASI_Rn01_00101004 predicted 456
3 SASI_Rn02_00267995 predicted 517
4 SASI_Rn01_00101006 predicted 786
5 SASI_Rn01_00101007 predicted 275
6 SASI_Rn01_00101008 predicted 380
7 SASI_Rn01_00101009 predicted 834
8 SASI_Rn01_00101010 predicted 445
9 SASI_Rn01_00101011 predicted 828
10 SASI_Rn01_00101012 predicted 457
11 SASI_Rn01_00101005 predicted 877
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025840 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152880 predicted 702
2 SASI_Mm01_00152881 predicted 253
3 SASI_Mm01_00152882 predicted 425
4 SASI_Mm02_00329116 predicted 251
5 SASI_Mm01_00152884 predicted 459
6 SASI_Mm01_00152885 predicted 424
7 SASI_Mm01_00152886 predicted 451
8 SASI_Mm02_00329117 predicted 746
9 SASI_Mm02_00329118 predicted 454
10 SASI_Mm02_00329119 predicted 643
11 SASI_Mm01_00152883 predicted 1137
12 SASI_Mm01_00152887 predicted 231
13 SASI_Mm01_00152888 predicted 695
14 SASI_Mm01_00152889 predicted 1059
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014038
VALIDATED
BZW2 MISSION shRNA Bacterial Glycerol Stock
basic leucine zipper and W2 domains 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014038.1-1283s1c1
Sequence:CCGGGCGAAGAAGCAATACTGAAATCTCGAGATTTCAGTATTGCTTCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014038.1-1243s1c1
Sequence:CCGGCAGAAGATTGTGGTTCTCTTTCTCGAGAAAGAGAACCACAATCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014038.1-1030s1c1
Sequence:CCGGGAAACAGCAGTGATTGGTCTTCTCGAGAAGACCAATCACTGCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014038.1-486s1c1
Sequence:CCGGCCGAAACTATGCTCAGGTCTTCTCGAGAAGACCTGAGCATAGTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014038.1-761s1c1
Sequence:CCGGCCAACTCTGTTACCTCGTCTTCTCGAGAAGACGAGGTAACAGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014038.1-438s1c1
Sequence:CCGGGATGACCAACCACTGTGTGTTCTCGAGAACACACAGTGGTTGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014038.1-1188s1c1
Sequence:CCGGCCTCCAGAAGGTTCAGGAATACTCGAGTATTCCTGAACCTTCTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014038.1-1270s1c1
Sequence:CCGGGCTGATGTTCTGAGCGAAGAACTCGAGTTCTTCGCTCAGAACATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014038.2-324s21c1
Sequence:CCGGTACAGGCTCAAGATTAGATTACTCGAGTAATCTAATCTTGAGCCTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014038
VALIDATED
BZW2 MISSION shRNA shRNA Plasmid DNA
basic leucine zipper and W2 domains 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014038.1-1283s1c1
Sequence:CCGGGCGAAGAAGCAATACTGAAATCTCGAGATTTCAGTATTGCTTCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014038.1-1243s1c1
Sequence:CCGGCAGAAGATTGTGGTTCTCTTTCTCGAGAAAGAGAACCACAATCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014038.1-1030s1c1
Sequence:CCGGGAAACAGCAGTGATTGGTCTTCTCGAGAAGACCAATCACTGCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014038.1-486s1c1
Sequence:CCGGCCGAAACTATGCTCAGGTCTTCTCGAGAAGACCTGAGCATAGTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014038.1-761s1c1
Sequence:CCGGCCAACTCTGTTACCTCGTCTTCTCGAGAAGACGAGGTAACAGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014038.1-438s1c1
Sequence:CCGGGATGACCAACCACTGTGTGTTCTCGAGAACACACAGTGGTTGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014038.1-1188s1c1
Sequence:CCGGCCTCCAGAAGGTTCAGGAATACTCGAGTATTCCTGAACCTTCTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014038.1-1270s1c1
Sequence:CCGGGCTGATGTTCTGAGCGAAGAACTCGAGTTCTTCGCTCAGAACATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014038.2-324s21c1
Sequence:CCGGTACAGGCTCAAGATTAGATTACTCGAGTAATCTAATCTTGAGCCTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014038
VALIDATED
BZW2 MISSION shRNA Lentiviral Transduction Particles
basic leucine zipper and W2 domains 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014038.1-1283s1c1
Sequence:CCGGGCGAAGAAGCAATACTGAAATCTCGAGATTTCAGTATTGCTTCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014038.1-1243s1c1
Sequence:CCGGCAGAAGATTGTGGTTCTCTTTCTCGAGAAAGAGAACCACAATCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014038.1-1030s1c1
Sequence:CCGGGAAACAGCAGTGATTGGTCTTCTCGAGAAGACCAATCACTGCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014038.1-486s1c1
Sequence:CCGGCCGAAACTATGCTCAGGTCTTCTCGAGAAGACCTGAGCATAGTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014038.1-761s1c1
Sequence:CCGGCCAACTCTGTTACCTCGTCTTCTCGAGAAGACGAGGTAACAGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014038.1-438s1c1
Sequence:CCGGGATGACCAACCACTGTGTGTTCTCGAGAACACACAGTGGTTGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014038.1-1188s1c1
Sequence:CCGGCCTCCAGAAGGTTCAGGAATACTCGAGTATTCCTGAACCTTCTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014038.1-1270s1c1
Sequence:CCGGGCTGATGTTCTGAGCGAAGAACTCGAGTTCTTCGCTCAGAACATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014038.2-324s21c1
Sequence:CCGGTACAGGCTCAAGATTAGATTACTCGAGTAATCTAATCTTGAGCCTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025840
BZW2 MISSION shRNA Bacterial Glycerol Stock
basic leucine zipper and W2 domains 2
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025840.2-1720s1c1
Sequence:CCGGGCCACTTCAATAGTTGTGTTTCTCGAGAAACACAACTATTGAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025840.2-1230s1c1
Sequence:CCGGGCGATACTGAAGTGGTATAAACTCGAGTTTATACCACTTCAGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025840.2-1000s1c1
Sequence:CCGGGCATCATGAATGCGGTGGAATCTCGAGATTCCACCGCATTCATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025840.2-273s1c1
Sequence:CCGGCGATTAGATTACCGTCGCTATCTCGAGATAGCGACGGTAATCTAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025840.2-425s1c1
Sequence:CCGGCCGAAACTATGCTCAGGTCTTCTCGAGAAGACCTGAGCATAGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025840.3-986s21c1
Sequence:CCGGAGGTGGTGCTTTACGTCAAAGCTCGAGCTTTGACGTAAAGCACCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025840.3-574s21c1
Sequence:CCGGCTCCTCTTCCTTAAAGCATTTCTCGAGAAATGCTTTAAGGAAGAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025840.3-296s21c1
Sequence:CCGGACCTTGAAGCTGTAGCCAAATCTCGAGATTTGGCTACAGCTTCAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025840.3-1205s21c1
Sequence:CCGGAGGAATACTGCTACGACAACACTCGAGTGTTGTCGTAGCAGTATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025840.3-517s21c1
Sequence:CCGGCTCATCAGGAGATACAAGTATCTCGAGATACTTGTATCTCCTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025840.3-1328s21c1
Sequence:CCGGCCAAAGGCAAGAGCGTCTTTCCTCGAGGAAAGACGCTCTTGCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025840.3-843s21c1
Sequence:CCGGTGTGGATCATTTCGCTAAGTACTCGAGTACTTAGCGAAATGATCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025840
BZW2 MISSION shRNA shRNA Plasmid DNA
basic leucine zipper and W2 domains 2
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025840.2-1720s1c1
Sequence:CCGGGCCACTTCAATAGTTGTGTTTCTCGAGAAACACAACTATTGAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025840.2-1230s1c1
Sequence:CCGGGCGATACTGAAGTGGTATAAACTCGAGTTTATACCACTTCAGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025840.2-1000s1c1
Sequence:CCGGGCATCATGAATGCGGTGGAATCTCGAGATTCCACCGCATTCATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025840.2-273s1c1
Sequence:CCGGCGATTAGATTACCGTCGCTATCTCGAGATAGCGACGGTAATCTAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025840.2-425s1c1
Sequence:CCGGCCGAAACTATGCTCAGGTCTTCTCGAGAAGACCTGAGCATAGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025840.3-986s21c1
Sequence:CCGGAGGTGGTGCTTTACGTCAAAGCTCGAGCTTTGACGTAAAGCACCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025840.3-574s21c1
Sequence:CCGGCTCCTCTTCCTTAAAGCATTTCTCGAGAAATGCTTTAAGGAAGAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025840.3-296s21c1
Sequence:CCGGACCTTGAAGCTGTAGCCAAATCTCGAGATTTGGCTACAGCTTCAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025840.3-1205s21c1
Sequence:CCGGAGGAATACTGCTACGACAACACTCGAGTGTTGTCGTAGCAGTATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025840.3-517s21c1
Sequence:CCGGCTCATCAGGAGATACAAGTATCTCGAGATACTTGTATCTCCTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025840.3-1328s21c1
Sequence:CCGGCCAAAGGCAAGAGCGTCTTTCCTCGAGGAAAGACGCTCTTGCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025840.3-843s21c1
Sequence:CCGGTGTGGATCATTTCGCTAAGTACTCGAGTACTTAGCGAAATGATCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025840
BZW2 MISSION shRNA Lentiviral Transduction Particles
basic leucine zipper and W2 domains 2
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025840.2-1720s1c1
Sequence:CCGGGCCACTTCAATAGTTGTGTTTCTCGAGAAACACAACTATTGAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025840.2-1230s1c1
Sequence:CCGGGCGATACTGAAGTGGTATAAACTCGAGTTTATACCACTTCAGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025840.2-1000s1c1
Sequence:CCGGGCATCATGAATGCGGTGGAATCTCGAGATTCCACCGCATTCATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025840.2-273s1c1
Sequence:CCGGCGATTAGATTACCGTCGCTATCTCGAGATAGCGACGGTAATCTAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025840.2-425s1c1
Sequence:CCGGCCGAAACTATGCTCAGGTCTTCTCGAGAAGACCTGAGCATAGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025840.3-986s21c1
Sequence:CCGGAGGTGGTGCTTTACGTCAAAGCTCGAGCTTTGACGTAAAGCACCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025840.3-574s21c1
Sequence:CCGGCTCCTCTTCCTTAAAGCATTTCTCGAGAAATGCTTTAAGGAAGAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025840.3-296s21c1
Sequence:CCGGACCTTGAAGCTGTAGCCAAATCTCGAGATTTGGCTACAGCTTCAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025840.3-1205s21c1
Sequence:CCGGAGGAATACTGCTACGACAACACTCGAGTGTTGTCGTAGCAGTATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025840.3-517s21c1
Sequence:CCGGCTCATCAGGAGATACAAGTATCTCGAGATACTTGTATCTCCTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025840.3-1328s21c1
Sequence:CCGGCCAAAGGCAAGAGCGTCTTTCCTCGAGGAAAGACGCTCTTGCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025840.3-843s21c1
Sequence:CCGGTGTGGATCATTTCGCTAAGTACTCGAGTACTTAGCGAAATGATCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks