EMAIL THIS PAGE TO A FRIEND

C10orf107

chromosome 10 open reading frame 107

37 Gene Product Result for
Synonyms: bA63A2.1
Species: Human C10orf107(219621)
UniProtKB ID: Q8IVU9, Q5T1B8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA041398 Anti-C10orf107 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173554 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173554 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173554 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU013661 MISSION® esiRNA esiRNA targeting human C10orf107 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173554 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173554 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212571 predicted 388
2 SASI_Hs01_00212572 predicted 577
3 SASI_Hs01_00212573 predicted 323
4 SASI_Hs01_00212574 predicted 501
5 SASI_Hs01_00212575 predicted 862
6 SASI_Hs01_00212576 predicted 578
7 SASI_Hs01_00212579 predicted 828
8 SASI_Hs01_00212580 predicted 432
9 SASI_Hs02_00368366 predicted 420
10 SASI_Hs02_00368367 predicted 547
11 SASI_Hs01_00212577 predicted 970
12 SASI_Hs01_00212578 predicted 963
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173554
C10orf107 MISSION shRNA Bacterial Glycerol Stock
chromosome 10 open reading frame 107
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173554.1-608s1c1
Sequence:CCGGGCAAGTGATAGAGGTTGTCAACTCGAGTTGACAACCTCTATCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167868    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173554.1-971s1c1
Sequence:CCGGGCTAAACTTCACAGAAACAAACTCGAGTTTGTTTCTGTGAAGTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173554.1-579s1c1
Sequence:CCGGGCCAGGGAAGAAATTGTGATACTCGAGTATCACAATTTCTTCCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173554.2-892s21c1
Sequence:CCGGAGGCCTTTAATGCACGAATAGCTCGAGCTATTCGTGCATTAAAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173554.2-823s21c1
Sequence:CCGGATCAAGTCACAGATGACATTTCTCGAGAAATGTCATCTGTGACTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173554.2-1009s21c1
Sequence:CCGGCGTCGTGTCTCCATCACTTAGCTCGAGCTAAGTGATGGAGACACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173554.2-532s21c1
Sequence:CCGGACTACAAGCTATACGAGTTTACTCGAGTAAACTCGTATAGCTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173554.2-765s21c1
Sequence:CCGGACCTCAGACATGGATCCTTTACTCGAGTAAAGGATCCATGTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173554
C10orf107 MISSION shRNA shRNA Plasmid DNA
chromosome 10 open reading frame 107
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173554.1-608s1c1
Sequence:CCGGGCAAGTGATAGAGGTTGTCAACTCGAGTTGACAACCTCTATCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167868    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173554.1-971s1c1
Sequence:CCGGGCTAAACTTCACAGAAACAAACTCGAGTTTGTTTCTGTGAAGTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173554.1-579s1c1
Sequence:CCGGGCCAGGGAAGAAATTGTGATACTCGAGTATCACAATTTCTTCCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173554.2-892s21c1
Sequence:CCGGAGGCCTTTAATGCACGAATAGCTCGAGCTATTCGTGCATTAAAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173554.2-823s21c1
Sequence:CCGGATCAAGTCACAGATGACATTTCTCGAGAAATGTCATCTGTGACTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173554.2-1009s21c1
Sequence:CCGGCGTCGTGTCTCCATCACTTAGCTCGAGCTAAGTGATGGAGACACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173554.2-532s21c1
Sequence:CCGGACTACAAGCTATACGAGTTTACTCGAGTAAACTCGTATAGCTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173554.2-765s21c1
Sequence:CCGGACCTCAGACATGGATCCTTTACTCGAGTAAAGGATCCATGTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173554
C10orf107 MISSION shRNA Lentiviral Transduction Particles
chromosome 10 open reading frame 107
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173554.1-608s1c1
Sequence:CCGGGCAAGTGATAGAGGTTGTCAACTCGAGTTGACAACCTCTATCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167868    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173554.1-971s1c1
Sequence:CCGGGCTAAACTTCACAGAAACAAACTCGAGTTTGTTTCTGTGAAGTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173554.1-579s1c1
Sequence:CCGGGCCAGGGAAGAAATTGTGATACTCGAGTATCACAATTTCTTCCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173554.2-892s21c1
Sequence:CCGGAGGCCTTTAATGCACGAATAGCTCGAGCTATTCGTGCATTAAAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173554.2-823s21c1
Sequence:CCGGATCAAGTCACAGATGACATTTCTCGAGAAATGTCATCTGTGACTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173554.2-1009s21c1
Sequence:CCGGCGTCGTGTCTCCATCACTTAGCTCGAGCTAAGTGATGGAGACACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173554.2-532s21c1
Sequence:CCGGACTACAAGCTATACGAGTTTACTCGAGTAAACTCGTATAGCTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173554.2-765s21c1
Sequence:CCGGACCTCAGACATGGATCCTTTACTCGAGTAAAGGATCCATGTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks