EMAIL THIS PAGE TO A FRIEND

C10orf10

chromosome 10 open reading frame 10

Synonyms: DEPP FIG
Species: Human C10orf10(11067)
Gene ID:
Human(11067) Summary: The expression of this gene is induced by fasting as well as by progesterone. The protein encoded by this gene contains a t-synaptosome-associated protein receptor (SNARE) coiled-coil homology domain and a peroxisomal targeting signal. Production of the encoded protein leads to phosphorylation and activation of the transcription factor ELK1. [provided by RefSeq, Jul 2008]
19 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA037819 Anti-C10orf10 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007021 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007021 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007021 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU043711 MISSION® esiRNA esiRNA human C10orf10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007021 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007021 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114036 predicted 318
2 SASI_Hs01_00114032 predicted 804
3 SASI_Hs01_00114033 predicted 868
4 SASI_Hs01_00114034 predicted 396
5 SASI_Hs01_00114035 predicted 534
6 SASI_Hs01_00114037 predicted 396
7 SASI_Hs02_00342783 predicted 1414
8 SASI_Hs01_00114039 predicted 411
9 SASI_Hs01_00114040 predicted 1406
10 SASI_Hs02_00342784 predicted 1360
11 SASI_Hs01_00114038 predicted 449
12 SASI_Hs01_00114041 predicted 879
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007021
C10orf10 MISSION shRNA Bacterial Glycerol Stock
chromosome 10 open reading frame 10
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007021.3-1105s21c1
Sequence:CCGGTTTCACATGAGGAGATGTTACCTCGAGGTAACATCTCCTCATGTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007021.3-1155s21c1
Sequence:CCGGTGATCACCTTGAGCAACTTACCTCGAGGTAAGTTGCTCAAGGTGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007021.3-1247s21c1
Sequence:CCGGTCTGACGTGTAACCGCATATACTCGAGTATATGCGGTTACACGTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007021.2-1117s1c1
Sequence:CCGGCCTCAGTTTCTCATGGGTAATCTCGAGATTACCCATGAGAAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007021.2-735s1c1
Sequence:CCGGCTGACCTAAGAAGCTGGACTTCTCGAGAAGTCCAGCTTCTTAGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007021.2-329s1c1
Sequence:CCGGGATGACTACGTGAGGTCTATACTCGAGTATAGACCTCACGTAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007021.2-807s1c1
Sequence:CCGGGTGTCCTCAGAACACTCTACTCTCGAGAGTAGAGTGTTCTGAGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007021.2-463s1c1
Sequence:CCGGGCGAGACATCACCGCACGTTTCTCGAGAAACGTGCGGTGATGTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007021
C10orf10 MISSION shRNA shRNA Plasmid DNA
chromosome 10 open reading frame 10
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007021.3-1105s21c1
Sequence:CCGGTTTCACATGAGGAGATGTTACCTCGAGGTAACATCTCCTCATGTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007021.3-1155s21c1
Sequence:CCGGTGATCACCTTGAGCAACTTACCTCGAGGTAAGTTGCTCAAGGTGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007021.3-1247s21c1
Sequence:CCGGTCTGACGTGTAACCGCATATACTCGAGTATATGCGGTTACACGTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007021.2-1117s1c1
Sequence:CCGGCCTCAGTTTCTCATGGGTAATCTCGAGATTACCCATGAGAAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007021.2-735s1c1
Sequence:CCGGCTGACCTAAGAAGCTGGACTTCTCGAGAAGTCCAGCTTCTTAGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007021.2-329s1c1
Sequence:CCGGGATGACTACGTGAGGTCTATACTCGAGTATAGACCTCACGTAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007021.2-807s1c1
Sequence:CCGGGTGTCCTCAGAACACTCTACTCTCGAGAGTAGAGTGTTCTGAGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007021.2-463s1c1
Sequence:CCGGGCGAGACATCACCGCACGTTTCTCGAGAAACGTGCGGTGATGTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007021
C10orf10 MISSION shRNA Lentiviral Transduction Particles
chromosome 10 open reading frame 10
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007021.3-1105s21c1
Sequence:CCGGTTTCACATGAGGAGATGTTACCTCGAGGTAACATCTCCTCATGTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007021.3-1155s21c1
Sequence:CCGGTGATCACCTTGAGCAACTTACCTCGAGGTAAGTTGCTCAAGGTGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007021.3-1247s21c1
Sequence:CCGGTCTGACGTGTAACCGCATATACTCGAGTATATGCGGTTACACGTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007021.2-1117s1c1
Sequence:CCGGCCTCAGTTTCTCATGGGTAATCTCGAGATTACCCATGAGAAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007021.2-735s1c1
Sequence:CCGGCTGACCTAAGAAGCTGGACTTCTCGAGAAGTCCAGCTTCTTAGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007021.2-329s1c1
Sequence:CCGGGATGACTACGTGAGGTCTATACTCGAGTATAGACCTCACGTAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007021.2-807s1c1
Sequence:CCGGGTGTCCTCAGAACACTCTACTCTCGAGAGTAGAGTGTTCTGAGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007021.2-463s1c1
Sequence:CCGGGCGAGACATCACCGCACGTTTCTCGAGAAACGTGCGGTGATGTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks