EMAIL THIS PAGE TO A FRIEND

C10orf111

chromosome 10 open reading frame 111

19 Gene Product Result for
Synonyms: bA455B2.4
Species: Human C10orf111(221060)
UniProtKB ID: Q8N326, B2RAC4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153244 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153244 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153244 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153244 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153244 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084129 predicted 393
2 SASI_Hs01_00084130 predicted 358
3 SASI_Hs01_00084131 predicted 479
4 SASI_Hs01_00084132 predicted 365
5 SASI_Hs01_00084133 predicted 389
6 SASI_Hs01_00084134 predicted 508
7 SASI_Hs01_00084135 predicted 385
8 SASI_Hs01_00084137 predicted 474
9 SASI_Hs01_00084138 predicted 424
10 SASI_Hs02_00367109 predicted 466
11 SASI_Hs01_00084136 predicted 424
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153244
C10orf111 MISSION shRNA Bacterial Glycerol Stock
chromosome 10 open reading frame 111
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153244.1-598s1c1
Sequence:CCGGGCAGGTTGCTTCTGACCTAATCTCGAGATTAGGTCAGAAGCAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153244.1-358s1c1
Sequence:CCGGCAATAATGCAGGGAATCTTGACTCGAGTCAAGATTCCCTGCATTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153244.1-700s1c1
Sequence:CCGGCAATCTCCTCACTGTTGGTTTCTCGAGAAACCAACAGTGAGGAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153244.1-1306s1c1
Sequence:CCGGGCTTGCATTTCCAAAGACAAACTCGAGTTTGTCTTTGGAAATGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153244.1-396s1c1
Sequence:CCGGCAGTAAGAGTTGCCTTGAGTTCTCGAGAACTCAAGGCAACTCTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168084    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153244.1-1061s1c1
Sequence:CCGGCCCAGCCTCTATGATTTCAATCTCGAGATTGAAATCATAGAGGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166920    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153244.1-1062s1c1
Sequence:CCGGCCAGCCTCTATGATTTCAATTCTCGAGAATTGAAATCATAGAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153244.1-1180s21c1
Sequence:CCGGGGGTAAAGTGCAGTATGATTTCTCGAGAAATCATACTGCACTTTACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153244.1-394s21c1
Sequence:CCGGGGCAGTAAGAGTTGCCTTGAGCTCGAGCTCAAGGCAACTCTTACTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153244.1-555s21c1
Sequence:CCGGATCTGGATCTGTTGATCTACCCTCGAGGGTAGATCAACAGATCCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153244
C10orf111 MISSION shRNA shRNA Plasmid DNA
chromosome 10 open reading frame 111
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153244.1-598s1c1
Sequence:CCGGGCAGGTTGCTTCTGACCTAATCTCGAGATTAGGTCAGAAGCAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153244.1-358s1c1
Sequence:CCGGCAATAATGCAGGGAATCTTGACTCGAGTCAAGATTCCCTGCATTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153244.1-700s1c1
Sequence:CCGGCAATCTCCTCACTGTTGGTTTCTCGAGAAACCAACAGTGAGGAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153244.1-1306s1c1
Sequence:CCGGGCTTGCATTTCCAAAGACAAACTCGAGTTTGTCTTTGGAAATGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153244.1-396s1c1
Sequence:CCGGCAGTAAGAGTTGCCTTGAGTTCTCGAGAACTCAAGGCAACTCTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168084    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153244.1-1061s1c1
Sequence:CCGGCCCAGCCTCTATGATTTCAATCTCGAGATTGAAATCATAGAGGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166920    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153244.1-1062s1c1
Sequence:CCGGCCAGCCTCTATGATTTCAATTCTCGAGAATTGAAATCATAGAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153244.1-1180s21c1
Sequence:CCGGGGGTAAAGTGCAGTATGATTTCTCGAGAAATCATACTGCACTTTACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153244.1-394s21c1
Sequence:CCGGGGCAGTAAGAGTTGCCTTGAGCTCGAGCTCAAGGCAACTCTTACTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153244.1-555s21c1
Sequence:CCGGATCTGGATCTGTTGATCTACCCTCGAGGGTAGATCAACAGATCCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153244
C10orf111 MISSION shRNA Lentiviral Transduction Particles
chromosome 10 open reading frame 111
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153244.1-598s1c1
Sequence:CCGGGCAGGTTGCTTCTGACCTAATCTCGAGATTAGGTCAGAAGCAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153244.1-358s1c1
Sequence:CCGGCAATAATGCAGGGAATCTTGACTCGAGTCAAGATTCCCTGCATTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153244.1-700s1c1
Sequence:CCGGCAATCTCCTCACTGTTGGTTTCTCGAGAAACCAACAGTGAGGAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153244.1-1306s1c1
Sequence:CCGGGCTTGCATTTCCAAAGACAAACTCGAGTTTGTCTTTGGAAATGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153244.1-396s1c1
Sequence:CCGGCAGTAAGAGTTGCCTTGAGTTCTCGAGAACTCAAGGCAACTCTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168084    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153244.1-1061s1c1
Sequence:CCGGCCCAGCCTCTATGATTTCAATCTCGAGATTGAAATCATAGAGGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166920    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153244.1-1062s1c1
Sequence:CCGGCCAGCCTCTATGATTTCAATTCTCGAGAATTGAAATCATAGAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153244.1-1180s21c1
Sequence:CCGGGGGTAAAGTGCAGTATGATTTCTCGAGAAATCATACTGCACTTTACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153244.1-394s21c1
Sequence:CCGGGGCAGTAAGAGTTGCCTTGAGCTCGAGCTCAAGGCAACTCTTACTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153244.1-555s21c1
Sequence:CCGGATCTGGATCTGTTGATCTACCCTCGAGGGTAGATCAACAGATCCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks