EMAIL THIS PAGE TO A FRIEND

C10orf113

chromosome 10 open reading frame 113

17 Gene Product Result for
Synonyms: bA165O3.1
Species: Human C10orf113(387638)
UniProtKB ID: Q5VZT2, B9EIM9, E9PRX7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010896 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010896 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010896 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010896 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010896 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201887 predicted 249
2 SASI_Hs02_00305876 predicted 291
3 SASI_Hs01_00201888 predicted 255
4 SASI_Hs01_00201889 predicted 252
5 SASI_Hs01_00201890 predicted 278
6 SASI_Hs01_00201891 predicted 232
7 SASI_Hs01_00201892 predicted 244
8 SASI_Hs01_00201893 predicted 263
9 SASI_Hs01_00201895 predicted 257
10 SASI_Hs01_00201896 predicted 251
11 SASI_Hs01_00201894 predicted 218
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010896
C10orf113 MISSION shRNA Bacterial Glycerol Stock
chromosome 10 open reading frame 113
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010896.1-58s1c1
Sequence:CCGGGCTGTCCTCTAGCTTATATGACTCGAGTCATATAAGCTAGAGGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010896.1-85s1c1
Sequence:CCGGGTGTTTGTGCTTTACTAATCACTCGAGTGATTAGTAAAGCACAAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167257    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010896.1-70s1c1
Sequence:CCGGCTTATATGAGAGAGAGTGTTTCTCGAGAAACACTCTCTCTCATATAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010896.1-64s1c1
Sequence:CCGGCTCTAGCTTATATGAGAGAGACTCGAGTCTCTCTCATATAAGCTAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010896.1-94s1c1
Sequence:CCGGCTTTACTAATCAACCAGTCATCTCGAGATGACTGGTTGATTAGTAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010896.1-361s1c1
Sequence:CCGGCAGAAGGTATAACCAAAGGGACTCGAGTCCCTTTGGTTATACCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010896.1-266s1c1
Sequence:CCGGGAGAGTCAGCTTCAGTCTCTACTCGAGTAGAGACTGAAGCTGACTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010896.1-66s1c1
Sequence:CCGGCTAGCTTATATGAGAGAGAGTCTCGAGACTCTCTCTCATATAAGCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010896.1-48s1c1
Sequence:CCGGGAAGATATTGGCTGTCCTCTACTCGAGTAGAGGACAGCCAATATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010896
C10orf113 MISSION shRNA shRNA Plasmid DNA
chromosome 10 open reading frame 113
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010896.1-58s1c1
Sequence:CCGGGCTGTCCTCTAGCTTATATGACTCGAGTCATATAAGCTAGAGGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010896.1-85s1c1
Sequence:CCGGGTGTTTGTGCTTTACTAATCACTCGAGTGATTAGTAAAGCACAAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167257    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010896.1-70s1c1
Sequence:CCGGCTTATATGAGAGAGAGTGTTTCTCGAGAAACACTCTCTCTCATATAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010896.1-64s1c1
Sequence:CCGGCTCTAGCTTATATGAGAGAGACTCGAGTCTCTCTCATATAAGCTAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010896.1-94s1c1
Sequence:CCGGCTTTACTAATCAACCAGTCATCTCGAGATGACTGGTTGATTAGTAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010896.1-361s1c1
Sequence:CCGGCAGAAGGTATAACCAAAGGGACTCGAGTCCCTTTGGTTATACCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010896.1-266s1c1
Sequence:CCGGGAGAGTCAGCTTCAGTCTCTACTCGAGTAGAGACTGAAGCTGACTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010896.1-66s1c1
Sequence:CCGGCTAGCTTATATGAGAGAGAGTCTCGAGACTCTCTCTCATATAAGCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010896.1-48s1c1
Sequence:CCGGGAAGATATTGGCTGTCCTCTACTCGAGTAGAGGACAGCCAATATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010896
C10orf113 MISSION shRNA Lentiviral Transduction Particles
chromosome 10 open reading frame 113
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010896.1-58s1c1
Sequence:CCGGGCTGTCCTCTAGCTTATATGACTCGAGTCATATAAGCTAGAGGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010896.1-85s1c1
Sequence:CCGGGTGTTTGTGCTTTACTAATCACTCGAGTGATTAGTAAAGCACAAACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167257    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010896.1-70s1c1
Sequence:CCGGCTTATATGAGAGAGAGTGTTTCTCGAGAAACACTCTCTCTCATATAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010896.1-64s1c1
Sequence:CCGGCTCTAGCTTATATGAGAGAGACTCGAGTCTCTCTCATATAAGCTAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010896.1-94s1c1
Sequence:CCGGCTTTACTAATCAACCAGTCATCTCGAGATGACTGGTTGATTAGTAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010896.1-361s1c1
Sequence:CCGGCAGAAGGTATAACCAAAGGGACTCGAGTCCCTTTGGTTATACCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010896.1-266s1c1
Sequence:CCGGGAGAGTCAGCTTCAGTCTCTACTCGAGTAGAGACTGAAGCTGACTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010896.1-66s1c1
Sequence:CCGGCTAGCTTATATGAGAGAGAGTCTCGAGACTCTCTCTCATATAAGCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010896.1-48s1c1
Sequence:CCGGGAAGATATTGGCTGTCCTCTACTCGAGTAGAGGACAGCCAATATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)