EMAIL THIS PAGE TO A FRIEND

C10orf118

chromosome 10 open reading frame 118

Species: Human C10orf118(55088)
Gene ID:
30 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018017 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018017 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018017 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU040291 MISSION® esiRNA esiRNA human C10orf118 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018017 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018017 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218050 predicted 1793
2 SASI_Hs01_00218051 predicted 2379
3 SASI_Hs01_00218052 predicted 1378
4 SASI_Hs01_00218053 predicted 2216
5 SASI_Hs02_00351117 predicted 1609
6 SASI_Hs01_00218054 predicted 2654
7 SASI_Hs01_00218056 predicted 1152
8 SASI_Hs01_00218057 predicted 2494
9 SASI_Hs01_00218058 predicted 2413
10 SASI_Hs02_00351118 predicted 2635
11 SASI_Hs01_00218049 predicted 1994
12 SASI_Hs01_00218055 predicted 780
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018017
VALIDATED
C10orf118 MISSION shRNA Bacterial Glycerol Stock
chromosome 10 open reading frame 118
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018017.2-3069s1c1
Sequence:CCGGGAGAAGAATCAGGCACACTTTCTCGAGAAAGTGTGCCTGATTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018017.2-2643s1c1
Sequence:CCGGCAGAAGTTAAAGCATTGAGTACTCGAGTACTCAATGCTTTAACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018017.2-1387s1c1
Sequence:CCGGGCAGCATATGAACACAATTAACTCGAGTTAATTGTGTTCATATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122252    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018017.2-3575s1c1
Sequence:CCGGCCTGTCATTGAATCTAAACAACTCGAGTTGTTTAGATTCAATGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018017.2-3285s1c1
Sequence:CCGGGAACAGAAATAGAACGTCTTACTCGAGTAAGACGTTCTATTTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018017
VALIDATED
C10orf118 MISSION shRNA shRNA Plasmid DNA
chromosome 10 open reading frame 118
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018017.2-3069s1c1
Sequence:CCGGGAGAAGAATCAGGCACACTTTCTCGAGAAAGTGTGCCTGATTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018017.2-2643s1c1
Sequence:CCGGCAGAAGTTAAAGCATTGAGTACTCGAGTACTCAATGCTTTAACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018017.2-1387s1c1
Sequence:CCGGGCAGCATATGAACACAATTAACTCGAGTTAATTGTGTTCATATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122252    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018017.2-3575s1c1
Sequence:CCGGCCTGTCATTGAATCTAAACAACTCGAGTTGTTTAGATTCAATGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018017.2-3285s1c1
Sequence:CCGGGAACAGAAATAGAACGTCTTACTCGAGTAAGACGTTCTATTTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018017
VALIDATED
C10orf118 MISSION shRNA Lentiviral Transduction Particles
chromosome 10 open reading frame 118
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018017.2-3069s1c1
Sequence:CCGGGAGAAGAATCAGGCACACTTTCTCGAGAAAGTGTGCCTGATTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018017.2-2643s1c1
Sequence:CCGGCAGAAGTTAAAGCATTGAGTACTCGAGTACTCAATGCTTTAACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018017.2-1387s1c1
Sequence:CCGGGCAGCATATGAACACAATTAACTCGAGTTAATTGTGTTCATATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122252    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018017.2-3575s1c1
Sequence:CCGGCCTGTCATTGAATCTAAACAACTCGAGTTGTTTAGATTCAATGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018017.2-3285s1c1
Sequence:CCGGGAACAGAAATAGAACGTCTTACTCGAGTAAGACGTTCTATTTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks