EMAIL THIS PAGE TO A FRIEND

C10orf11

chromosome 10 open reading frame 11

20 Gene Product Result for
Synonyms: OCA5 OCA7
UniProtKB ID: Q9H2I8, B1AVW6
Gene ID:
Zebrafish(553730) c10orf11 homolog (H. sapiens)
chicken(770056) chromosome 6 open reading frame, human C10orf11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032024 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032024 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032024 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032024 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032024 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160483 predicted 338
2 SASI_Hs01_00160484 predicted 351
3 SASI_Hs01_00160485 predicted 470
4 SASI_Hs01_00160486 predicted 506
5 SASI_Hs01_00160487 predicted 325
6 SASI_Hs02_00359210 predicted 564
7 SASI_Hs01_00160489 predicted 382
8 SASI_Hs01_00160490 predicted 289
9 SASI_Hs01_00160491 predicted 518
10 SASI_Hs01_00160492 predicted 367
11 SASI_Hs01_00160488 predicted 238
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032024
C10orf11 MISSION shRNA Bacterial Glycerol Stock
chromosome 10 open reading frame 11
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032024.2-528s1c1
Sequence:CCGGCAGATGCTTTGTTCTGTACAACTCGAGTTGTACAGAACAAAGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032024.2-381s1c1
Sequence:CCGGCAAGAACCGAATCACTGATTTCTCGAGAAATCAGTGATTCGGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032024.2-301s1c1
Sequence:CCGGGAACTCATCTTGGACAACAATCTCGAGATTGTTGTCCAAGATGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032024.2-522s1c1
Sequence:CCGGGAGATACAGATGCTTTGTTCTCTCGAGAGAACAAAGCATCTGTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032024.2-577s1c1
Sequence:CCGGCAGAAAGTAACCAGACAAGAACTCGAGTTCTTGTCTGGTTACTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032024.2-553s1c1
Sequence:CCGGCCCAACTTGAAATTTCTGGATCTCGAGATCCAGAAATTTCAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032024.2-516s1c1
Sequence:CCGGCTACAAGAGATACAGATGCTTCTCGAGAAGCATCTGTATCTCTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032024.2-511s1c1
Sequence:CCGGGAAGACTACAAGAGATACAGACTCGAGTCTGTATCTCTTGTAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032024.2-751s1c1
Sequence:CCGGCGCTACGTTTACTATGGGAAACTCGAGTTTCCCATAGTAAACGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032024.2-357s1c1
Sequence:CCGGCAGACTGCATACCTTAACCCTCTCGAGAGGGTTAAGGTATGCAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032024.2-574s1c1
Sequence:CCGGGCCCAGAAAGTAACCAGACAACTCGAGTTGTCTGGTTACTTTCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032024.2-397s1c1
Sequence:CCGGGATTTGGAGAACCTGCTGGATCTCGAGATCCAGCAGGTTCTCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032024.2-744s1c1
Sequence:CCGGGAAGTGTCGCTACGTTTACTACTCGAGTAGTAAACGTAGCGACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032024.2-505s1c1
Sequence:CCGGGATGAGGAAGACTACAAGAGACTCGAGTCTCTTGTAGTCTTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032024.2-615s1c1
Sequence:CCGGCAGAGGAGTCTTCATGAAGGTCTCGAGACCTTCATGAAGACTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032024.2-306s1c1
Sequence:CCGGCATCTTGGACAACAATCAGCTCTCGAGAGCTGATTGTTGTCCAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032024.2-546s1c1
Sequence:CCGGCAAGCTGCCCAACTTGAAATTCTCGAGAATTTCAAGTTGGGCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032024
C10orf11 MISSION shRNA shRNA Plasmid DNA
chromosome 10 open reading frame 11
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032024.2-528s1c1
Sequence:CCGGCAGATGCTTTGTTCTGTACAACTCGAGTTGTACAGAACAAAGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032024.2-381s1c1
Sequence:CCGGCAAGAACCGAATCACTGATTTCTCGAGAAATCAGTGATTCGGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032024.2-301s1c1
Sequence:CCGGGAACTCATCTTGGACAACAATCTCGAGATTGTTGTCCAAGATGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032024.2-522s1c1
Sequence:CCGGGAGATACAGATGCTTTGTTCTCTCGAGAGAACAAAGCATCTGTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032024.2-577s1c1
Sequence:CCGGCAGAAAGTAACCAGACAAGAACTCGAGTTCTTGTCTGGTTACTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032024.2-553s1c1
Sequence:CCGGCCCAACTTGAAATTTCTGGATCTCGAGATCCAGAAATTTCAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032024.2-516s1c1
Sequence:CCGGCTACAAGAGATACAGATGCTTCTCGAGAAGCATCTGTATCTCTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032024.2-511s1c1
Sequence:CCGGGAAGACTACAAGAGATACAGACTCGAGTCTGTATCTCTTGTAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032024.2-751s1c1
Sequence:CCGGCGCTACGTTTACTATGGGAAACTCGAGTTTCCCATAGTAAACGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032024.2-357s1c1
Sequence:CCGGCAGACTGCATACCTTAACCCTCTCGAGAGGGTTAAGGTATGCAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032024.2-574s1c1
Sequence:CCGGGCCCAGAAAGTAACCAGACAACTCGAGTTGTCTGGTTACTTTCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032024.2-397s1c1
Sequence:CCGGGATTTGGAGAACCTGCTGGATCTCGAGATCCAGCAGGTTCTCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032024.2-744s1c1
Sequence:CCGGGAAGTGTCGCTACGTTTACTACTCGAGTAGTAAACGTAGCGACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032024.2-505s1c1
Sequence:CCGGGATGAGGAAGACTACAAGAGACTCGAGTCTCTTGTAGTCTTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032024.2-615s1c1
Sequence:CCGGCAGAGGAGTCTTCATGAAGGTCTCGAGACCTTCATGAAGACTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032024.2-306s1c1
Sequence:CCGGCATCTTGGACAACAATCAGCTCTCGAGAGCTGATTGTTGTCCAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032024.2-546s1c1
Sequence:CCGGCAAGCTGCCCAACTTGAAATTCTCGAGAATTTCAAGTTGGGCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032024
C10orf11 MISSION shRNA Lentiviral Transduction Particles
chromosome 10 open reading frame 11
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032024.2-528s1c1
Sequence:CCGGCAGATGCTTTGTTCTGTACAACTCGAGTTGTACAGAACAAAGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032024.2-381s1c1
Sequence:CCGGCAAGAACCGAATCACTGATTTCTCGAGAAATCAGTGATTCGGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032024.2-301s1c1
Sequence:CCGGGAACTCATCTTGGACAACAATCTCGAGATTGTTGTCCAAGATGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032024.2-522s1c1
Sequence:CCGGGAGATACAGATGCTTTGTTCTCTCGAGAGAACAAAGCATCTGTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032024.2-577s1c1
Sequence:CCGGCAGAAAGTAACCAGACAAGAACTCGAGTTCTTGTCTGGTTACTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032024.2-553s1c1
Sequence:CCGGCCCAACTTGAAATTTCTGGATCTCGAGATCCAGAAATTTCAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032024.2-516s1c1
Sequence:CCGGCTACAAGAGATACAGATGCTTCTCGAGAAGCATCTGTATCTCTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032024.2-511s1c1
Sequence:CCGGGAAGACTACAAGAGATACAGACTCGAGTCTGTATCTCTTGTAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032024.2-751s1c1
Sequence:CCGGCGCTACGTTTACTATGGGAAACTCGAGTTTCCCATAGTAAACGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032024.2-357s1c1
Sequence:CCGGCAGACTGCATACCTTAACCCTCTCGAGAGGGTTAAGGTATGCAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032024.2-574s1c1
Sequence:CCGGGCCCAGAAAGTAACCAGACAACTCGAGTTGTCTGGTTACTTTCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032024.2-397s1c1
Sequence:CCGGGATTTGGAGAACCTGCTGGATCTCGAGATCCAGCAGGTTCTCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032024.2-744s1c1
Sequence:CCGGGAAGTGTCGCTACGTTTACTACTCGAGTAGTAAACGTAGCGACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032024.2-505s1c1
Sequence:CCGGGATGAGGAAGACTACAAGAGACTCGAGTCTCTTGTAGTCTTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032024.2-615s1c1
Sequence:CCGGCAGAGGAGTCTTCATGAAGGTCTCGAGACCTTCATGAAGACTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032024.2-306s1c1
Sequence:CCGGCATCTTGGACAACAATCAGCTCTCGAGAGCTGATTGTTGTCCAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032024.2-546s1c1
Sequence:CCGGCAAGCTGCCCAACTTGAAATTCTCGAGAATTTCAAGTTGGGCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks