EMAIL THIS PAGE TO A FRIEND

C10orf120

chromosome 10 open reading frame 120

21 Gene Product Result for
Synonyms: bA318C4.1
Species: Human C10orf120(399814)
UniProtKB ID: Q5SQS8, B2RU17
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302871 ANTI-C10ORF120 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010912 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010912 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010912 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU033581 MISSION® esiRNA esiRNA human C10orf120 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010912 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010912 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240062 predicted 515
2 SASI_Hs02_00305896 predicted 318
3 SASI_Hs01_00240063 predicted 366
4 SASI_Hs02_00305897 predicted 547
5 SASI_Hs01_00240064 predicted 800
6 SASI_Hs01_00240065 predicted 239
7 SASI_Hs01_00240066 predicted 345
8 SASI_Hs01_00240067 predicted 593
9 SASI_Hs01_00240068 predicted 672
10 SASI_Hs01_00240069 predicted 511
11 SASI_Hs01_00240070 predicted 280
12 SASI_Hs01_00240071 predicted 210
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010912
C10orf120 MISSION shRNA Bacterial Glycerol Stock
chromosome 10 open reading frame 120
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010912.1-194s21c1
Sequence:CCGGTGCTTCACCGTTGCGGATATGCTCGAGCATATCCGCAACGGTGAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010912.1-805s21c1
Sequence:CCGGACCATGGAAATGATCGCAAATCTCGAGATTTGCGATCATTTCCATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010912.1-861s1c1
Sequence:CCGGGCAGGCCTAACAAACCGAAATCTCGAGATTTCGGTTTGTTAGGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010912.1-865s1c1
Sequence:CCGGGCCTAACAAACCGAAATCTTTCTCGAGAAAGATTTCGGTTTGTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010912.1-696s1c1
Sequence:CCGGGATGCCAACCAAGATAAGAAACTCGAGTTTCTTATCTTGGTTGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010912.1-304s1c1
Sequence:CCGGCCATAGCAGCAAGAAGGCTTTCTCGAGAAAGCCTTCTTGCTGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010912.1-345s1c1
Sequence:CCGGGAATGCAGAATGCTCAAGGAACTCGAGTTCCTTGAGCATTCTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010912.1-561s1c1
Sequence:CCGGCTGGGAAATCATCAGCCTTTACTCGAGTAAAGGCTGATGATTTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010912.1-666s1c1
Sequence:CCGGGAAGACAACTATGACACCCATCTCGAGATGGGTGTCATAGTTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010912
C10orf120 MISSION shRNA shRNA Plasmid DNA
chromosome 10 open reading frame 120
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010912.1-194s21c1
Sequence:CCGGTGCTTCACCGTTGCGGATATGCTCGAGCATATCCGCAACGGTGAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010912.1-805s21c1
Sequence:CCGGACCATGGAAATGATCGCAAATCTCGAGATTTGCGATCATTTCCATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010912.1-861s1c1
Sequence:CCGGGCAGGCCTAACAAACCGAAATCTCGAGATTTCGGTTTGTTAGGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010912.1-865s1c1
Sequence:CCGGGCCTAACAAACCGAAATCTTTCTCGAGAAAGATTTCGGTTTGTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010912.1-696s1c1
Sequence:CCGGGATGCCAACCAAGATAAGAAACTCGAGTTTCTTATCTTGGTTGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010912.1-304s1c1
Sequence:CCGGCCATAGCAGCAAGAAGGCTTTCTCGAGAAAGCCTTCTTGCTGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010912.1-345s1c1
Sequence:CCGGGAATGCAGAATGCTCAAGGAACTCGAGTTCCTTGAGCATTCTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010912.1-561s1c1
Sequence:CCGGCTGGGAAATCATCAGCCTTTACTCGAGTAAAGGCTGATGATTTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010912.1-666s1c1
Sequence:CCGGGAAGACAACTATGACACCCATCTCGAGATGGGTGTCATAGTTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010912
C10orf120 MISSION shRNA Lentiviral Transduction Particles
chromosome 10 open reading frame 120
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010912.1-194s21c1
Sequence:CCGGTGCTTCACCGTTGCGGATATGCTCGAGCATATCCGCAACGGTGAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010912.1-805s21c1
Sequence:CCGGACCATGGAAATGATCGCAAATCTCGAGATTTGCGATCATTTCCATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010912.1-861s1c1
Sequence:CCGGGCAGGCCTAACAAACCGAAATCTCGAGATTTCGGTTTGTTAGGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010912.1-865s1c1
Sequence:CCGGGCCTAACAAACCGAAATCTTTCTCGAGAAAGATTTCGGTTTGTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010912.1-696s1c1
Sequence:CCGGGATGCCAACCAAGATAAGAAACTCGAGTTTCTTATCTTGGTTGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010912.1-304s1c1
Sequence:CCGGCCATAGCAGCAAGAAGGCTTTCTCGAGAAAGCCTTCTTGCTGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010912.1-345s1c1
Sequence:CCGGGAATGCAGAATGCTCAAGGAACTCGAGTTCCTTGAGCATTCTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010912.1-561s1c1
Sequence:CCGGCTGGGAAATCATCAGCCTTTACTCGAGTAAAGGCTGATGATTTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010912.1-666s1c1
Sequence:CCGGGAAGACAACTATGACACCCATCTCGAGATGGGTGTCATAGTTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks