EMAIL THIS PAGE TO A FRIEND

C10orf128

chromosome 10 open reading frame 128

95 Gene Product Result for
Species: Human C10orf128(170371)
UniProtKB ID: Q5T292, A6XND2, Q5T289, Q5T291
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010863 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010863 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010863 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU219001 MISSION® esiRNA esiRNA targeting human C10orf128 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010863 Rosetta Predictions human pricing
XM_926220 Rosetta Predictions human pricing
XM_931091 Rosetta Predictions human pricing
XM_931097 Rosetta Predictions human pricing
XM_931104 Rosetta Predictions human pricing
XM_931112 Rosetta Predictions human pricing
XM_931121 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010863 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305810 predicted 207
2 SASI_Hs02_00305811 predicted 176
3 SASI_Hs02_00305812 predicted 260
4 SASI_Hs02_00305813 predicted 73
5 SASI_Hs02_00305814 predicted 293
6 SASI_Hs02_00305815 predicted 325
7 SASI_Hs02_00305816 predicted 205
8 SASI_Hs02_00305817 predicted 214
9 SASI_Hs02_00305818 predicted 191
10 SASI_Hs02_00305819 predicted 253
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_926220 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00271284 predicted 885
2 SASI_Hs01_00271285 predicted 855
3 SASI_Hs01_00271286 predicted 676
4 SASI_Hs01_00271287 predicted 792
5 SASI_Hs01_00271288 predicted 687
6 SASI_Hs01_00271289 predicted 798
7 SASI_Hs01_00271290 predicted 685
8 SASI_Hs01_00271291 predicted 882
9 SASI_Hs01_00271292 predicted 798
10 SASI_Hs01_00271293 predicted 691
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931091 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00277157 predicted 330
2 SASI_Hs01_00277158 predicted 353
3 SASI_Hs01_00277159 predicted 322
4 SASI_Hs01_00277160 predicted 214
5 SASI_Hs01_00277161 predicted 289
6 SASI_Hs01_00277162 predicted 354
7 SASI_Hs01_00277163 predicted 341
8 SASI_Hs01_00277164 predicted 277
9 SASI_Hs01_00277165 predicted 347
10 SASI_Hs01_00277166 predicted 343
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931097 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00274931 predicted 376
2 SASI_Hs01_00274932 predicted 516
3 SASI_Hs01_00274933 predicted 869
4 SASI_Hs01_00274934 predicted 414
5 SASI_Hs01_00274935 predicted 220
6 SASI_Hs01_00274936 predicted 200
7 SASI_Hs01_00274937 predicted 478
8 SASI_Hs01_00274938 predicted 834
9 SASI_Hs01_00274939 predicted 855
10 SASI_Hs01_00274940 predicted 550
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931104 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00260723 predicted 1352
2 SASI_Hs01_00260724 predicted 1358
3 SASI_Hs01_00260725 predicted 886
4 SASI_Hs01_00260726 predicted 996
5 SASI_Hs01_00260727 predicted 1340
6 SASI_Hs01_00260728 predicted 992
7 SASI_Hs01_00260729 predicted 1284
8 SASI_Hs01_00260730 predicted 957
9 SASI_Hs01_00260731 predicted 960
10 SASI_Hs01_00260732 predicted 1313
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931112 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00275798 predicted 802
2 SASI_Hs01_00275799 predicted 332
3 SASI_Hs01_00275800 predicted 441
4 SASI_Hs01_00275801 predicted 270
5 SASI_Hs01_00275802 predicted 792
6 SASI_Hs01_00275803 predicted 434
7 SASI_Hs01_00275804 predicted 723
8 SASI_Hs01_00275805 predicted 224
9 SASI_Hs01_00275806 predicted 237
10 SASI_Hs01_00275807 predicted 211
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931121 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00298027 predicted 402
2 SASI_Hs01_00298028 predicted 428
3 SASI_Hs01_00298029 predicted 413
4 SASI_Hs01_00298030 predicted 543
5 SASI_Hs01_00298031 predicted 403
6 SASI_Hs01_00298032 predicted 893
7 SASI_Hs01_00298033 predicted 361
8 SASI_Hs01_00298034 predicted 435
9 SASI_Hs01_00298035 predicted 897
10 SASI_Hs01_00298036 predicted 355
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010863
C10orf128 MISSION shRNA Bacterial Glycerol Stock
chromosome 10 open reading frame 128
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010863.1-200s21c1
Sequence:CCGGGATCAGGAGGCACTTATTTGACTCGAGTCAAATAAGTGCCTCCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010863.1-55s21c1
Sequence:CCGGTCCTCTTCCTCCTGGATGTAGCTCGAGCTACATCCAGGAGGAAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010863.1-211s21c1
Sequence:CCGGACTTATTTGACGACGACTCTTCTCGAGAAGAGTCGTCGTCAAATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010863.1-182s21c1
Sequence:CCGGGGCCCTGAAGATCTGCATGATCTCGAGATCATGCAGATCTTCAGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010863.1-83s21c1
Sequence:CCGGTCAAGTGCTGGCAACAGGCAACTCGAGTTGCCTGTTGCCAGCACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010863.1-158s21c1
Sequence:CCGGTGTCGCCATATCTGCTGGCTTCTCGAGAAGCCAGCAGATATGGCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010863.1-122s21c1
Sequence:CCGGTGATTTCAAGTACGCCCTCATCTCGAGATGAGGGCGTACTTGAAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010863
C10orf128 MISSION shRNA shRNA Plasmid DNA
chromosome 10 open reading frame 128
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010863.1-200s21c1
Sequence:CCGGGATCAGGAGGCACTTATTTGACTCGAGTCAAATAAGTGCCTCCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010863.1-55s21c1
Sequence:CCGGTCCTCTTCCTCCTGGATGTAGCTCGAGCTACATCCAGGAGGAAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010863.1-211s21c1
Sequence:CCGGACTTATTTGACGACGACTCTTCTCGAGAAGAGTCGTCGTCAAATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010863.1-182s21c1
Sequence:CCGGGGCCCTGAAGATCTGCATGATCTCGAGATCATGCAGATCTTCAGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010863.1-83s21c1
Sequence:CCGGTCAAGTGCTGGCAACAGGCAACTCGAGTTGCCTGTTGCCAGCACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010863.1-158s21c1
Sequence:CCGGTGTCGCCATATCTGCTGGCTTCTCGAGAAGCCAGCAGATATGGCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010863.1-122s21c1
Sequence:CCGGTGATTTCAAGTACGCCCTCATCTCGAGATGAGGGCGTACTTGAAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010863
C10orf128 MISSION shRNA Lentiviral Transduction Particles
chromosome 10 open reading frame 128
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010863.1-200s21c1
Sequence:CCGGGATCAGGAGGCACTTATTTGACTCGAGTCAAATAAGTGCCTCCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010863.1-55s21c1
Sequence:CCGGTCCTCTTCCTCCTGGATGTAGCTCGAGCTACATCCAGGAGGAAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010863.1-211s21c1
Sequence:CCGGACTTATTTGACGACGACTCTTCTCGAGAAGAGTCGTCGTCAAATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010863.1-182s21c1
Sequence:CCGGGGCCCTGAAGATCTGCATGATCTCGAGATCATGCAGATCTTCAGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010863.1-83s21c1
Sequence:CCGGTCAAGTGCTGGCAACAGGCAACTCGAGTTGCCTGTTGCCAGCACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010863.1-158s21c1
Sequence:CCGGTGTCGCCATATCTGCTGGCTTCTCGAGAAGCCAGCAGATATGGCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010863.1-122s21c1
Sequence:CCGGTGATTTCAAGTACGCCCTCATCTCGAGATGAGGGCGTACTTGAAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks