EMAIL THIS PAGE TO A FRIEND

C10orf129

chromosome 10 open reading frame 129

117 Gene Product Result for
Synonyms: ACSM6 bA310E22.3
Species: Human C10orf129(142827)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207321 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207321 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207321 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207321 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207321 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373861 predicted 1081
2 SASI_Hs01_00140577 predicted 759
3 SASI_Hs01_00140578 predicted 1167
4 SASI_Hs01_00140579 predicted 765
5 SASI_Hs01_00140580 predicted 1163
6 SASI_Hs01_00140582 predicted 1040
7 SASI_Hs02_00373862 predicted 976
8 SASI_Hs01_00140583 predicted 794
9 SASI_Hs01_00140584 predicted 687
10 SASI_Hs01_00140585 predicted 694
11 SASI_Hs01_00140581 predicted 1259
12 SASI_Hs01_00140586 predicted 1112
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207321
C10orf129 MISSION shRNA Bacterial Glycerol Stock
chromosome 10 open reading frame 129
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207321.2-1188s21c1
Sequence:CCGGGACTGGAAACGCATCACTAAGCTCGAGCTTAGTGATGCGTTTCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207321.2-1369s21c1
Sequence:CCGGGAAATATTGCAATCCGCATAACTCGAGTTATGCGGATTGCAATATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207321.2-701s21c1
Sequence:CCGGCTATGATGGGTGGTTGGATTTCTCGAGAAATCCAACCACCCATCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207321.1-1044s1c1
Sequence:CCGGCCATCACCACTCTATCTGCAACTCGAGTTGCAGATAGAGTGGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207321.1-890s1c1
Sequence:CCGGCCAACAGATGTCTTGTGGAGTCTCGAGACTCCACAAGACATCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207321.1-1022s1c1
Sequence:CCGGCTAAATGTCCTGTCCAGATTTCTCGAGAAATCTGGACAGGACATTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207321.1-1174s1c1
Sequence:CCGGCCACCTTATATTGTCCAGATTCTCGAGAATCTGGACAATATAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152516    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207321.1-1173s1c1
Sequence:CCGGGCCACCTTATATTGTCCAGATCTCGAGATCTGGACAATATAAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207321.1-766s1c1
Sequence:CCGGCCAAGATCCAATGGCCATATTCTCGAGAATATGGCCATTGGATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207321.1-1849s1c1
Sequence:CCGGCCTCACTTTCTAGGCTTACATCTCGAGATGTAAGCCTAGAAAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207321.1-1070s1c1
Sequence:CCGGGAGATGTACCAGGAACTGCTTCTCGAGAAGCAGTTCCTGGTACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207321
C10orf129 MISSION shRNA shRNA Plasmid DNA
chromosome 10 open reading frame 129
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207321.2-1188s21c1
Sequence:CCGGGACTGGAAACGCATCACTAAGCTCGAGCTTAGTGATGCGTTTCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207321.2-1369s21c1
Sequence:CCGGGAAATATTGCAATCCGCATAACTCGAGTTATGCGGATTGCAATATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207321.2-701s21c1
Sequence:CCGGCTATGATGGGTGGTTGGATTTCTCGAGAAATCCAACCACCCATCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207321.1-1044s1c1
Sequence:CCGGCCATCACCACTCTATCTGCAACTCGAGTTGCAGATAGAGTGGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207321.1-890s1c1
Sequence:CCGGCCAACAGATGTCTTGTGGAGTCTCGAGACTCCACAAGACATCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207321.1-1022s1c1
Sequence:CCGGCTAAATGTCCTGTCCAGATTTCTCGAGAAATCTGGACAGGACATTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207321.1-1174s1c1
Sequence:CCGGCCACCTTATATTGTCCAGATTCTCGAGAATCTGGACAATATAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152516    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207321.1-1173s1c1
Sequence:CCGGGCCACCTTATATTGTCCAGATCTCGAGATCTGGACAATATAAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207321.1-766s1c1
Sequence:CCGGCCAAGATCCAATGGCCATATTCTCGAGAATATGGCCATTGGATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207321.1-1849s1c1
Sequence:CCGGCCTCACTTTCTAGGCTTACATCTCGAGATGTAAGCCTAGAAAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207321.1-1070s1c1
Sequence:CCGGGAGATGTACCAGGAACTGCTTCTCGAGAAGCAGTTCCTGGTACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207321
C10orf129 MISSION shRNA Lentiviral Transduction Particles
chromosome 10 open reading frame 129
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207321.2-1188s21c1
Sequence:CCGGGACTGGAAACGCATCACTAAGCTCGAGCTTAGTGATGCGTTTCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207321.2-1369s21c1
Sequence:CCGGGAAATATTGCAATCCGCATAACTCGAGTTATGCGGATTGCAATATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207321.2-701s21c1
Sequence:CCGGCTATGATGGGTGGTTGGATTTCTCGAGAAATCCAACCACCCATCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207321.1-1044s1c1
Sequence:CCGGCCATCACCACTCTATCTGCAACTCGAGTTGCAGATAGAGTGGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207321.1-890s1c1
Sequence:CCGGCCAACAGATGTCTTGTGGAGTCTCGAGACTCCACAAGACATCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207321.1-1022s1c1
Sequence:CCGGCTAAATGTCCTGTCCAGATTTCTCGAGAAATCTGGACAGGACATTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207321.1-1174s1c1
Sequence:CCGGCCACCTTATATTGTCCAGATTCTCGAGAATCTGGACAATATAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152516    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207321.1-1173s1c1
Sequence:CCGGGCCACCTTATATTGTCCAGATCTCGAGATCTGGACAATATAAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207321.1-766s1c1
Sequence:CCGGCCAAGATCCAATGGCCATATTCTCGAGAATATGGCCATTGGATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207321.1-1849s1c1
Sequence:CCGGCCTCACTTTCTAGGCTTACATCTCGAGATGTAAGCCTAGAAAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207321.1-1070s1c1
Sequence:CCGGGAGATGTACCAGGAACTGCTTCTCGAGAAGCAGTTCCTGGTACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks