EMAIL THIS PAGE TO A FRIEND

C10orf131

chromosome 10 open reading frame 131

35 Gene Product Result for
Synonyms: bA690P14.3
UniProtKB ID: A6NCD4, B1AMZ2, B4DG41
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA072122 Anti-C10orf131 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001130446 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001130446 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001130446 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU149201 MISSION® esiRNA esiRNA human C10orf131 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001718641 Rosetta Predictions human pricing
XM_001724733 Rosetta Predictions human pricing
XM_001725104 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718641 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00425340 predicted 435
2 SASI_Hs02_00425341 predicted 424
3 SASI_Hs02_00425342 predicted 575
4 SASI_Hs02_00425343 predicted 427
5 SASI_Hs02_00425344 predicted 510
6 SASI_Hs02_00425345 predicted 428
7 SASI_Hs02_00425346 predicted 415
8 SASI_Hs02_00425347 predicted 450
9 SASI_Hs02_00425348 predicted 505
10 SASI_Hs02_00425349 predicted 415
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001724733 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00463343 predicted 435
2 SASI_Hs02_00463344 predicted 432
3 SASI_Hs02_00463345 predicted 575
4 SASI_Hs02_00463346 predicted 420
5 SASI_Hs02_00463347 predicted 502
6 SASI_Hs02_00463348 predicted 430
7 SASI_Hs02_00463349 predicted 419
8 SASI_Hs02_00463350 predicted 459
9 SASI_Hs02_00463351 predicted 503
10 SASI_Hs02_00463352 predicted 419
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725104 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00465657 predicted 432
2 SASI_Hs02_00465658 predicted 431
3 SASI_Hs02_00465659 predicted 575
4 SASI_Hs02_00465660 predicted 418
5 SASI_Hs02_00465661 predicted 506
6 SASI_Hs02_00465662 predicted 421
7 SASI_Hs02_00465663 predicted 415
8 SASI_Hs02_00465664 predicted 454
9 SASI_Hs02_00465665 predicted 502
10 SASI_Hs02_00465666 predicted 422
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001130446
C10orf131 MISSION shRNA Bacterial Glycerol Stock
chromosome 10 open reading frame 131
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000272462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130446.2-696s21c1
Sequence:CCGGGTAGTTCTCCAGGTAACATTCCTCGAGGAATGTTACCTGGAGAACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130446.2-509s21c1
Sequence:CCGGAGACCAGTAAACCGTAGTTATCTCGAGATAACTACGGTTTACTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130446.2-427s21c1
Sequence:CCGGTGAAGTCTCATTGGATGAAAGCTCGAGCTTTCATCCAATGAGACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130446.2-377s21c1
Sequence:CCGGCAGCTCATTGATAGCGAAATACTCGAGTATTTCGCTATCAATGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001130446.2-733s21c1
Sequence:CCGGTCAAGTCATTAACGAATTATGCTCGAGCATAATTCGTTAATGACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001130446
C10orf131 MISSION shRNA shRNA Plasmid DNA
chromosome 10 open reading frame 131
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000272462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130446.2-696s21c1
Sequence:CCGGGTAGTTCTCCAGGTAACATTCCTCGAGGAATGTTACCTGGAGAACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130446.2-509s21c1
Sequence:CCGGAGACCAGTAAACCGTAGTTATCTCGAGATAACTACGGTTTACTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130446.2-427s21c1
Sequence:CCGGTGAAGTCTCATTGGATGAAAGCTCGAGCTTTCATCCAATGAGACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130446.2-377s21c1
Sequence:CCGGCAGCTCATTGATAGCGAAATACTCGAGTATTTCGCTATCAATGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001130446.2-733s21c1
Sequence:CCGGTCAAGTCATTAACGAATTATGCTCGAGCATAATTCGTTAATGACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001130446
C10orf131 MISSION shRNA Lentiviral Transduction Particles
chromosome 10 open reading frame 131
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000272462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130446.2-696s21c1
Sequence:CCGGGTAGTTCTCCAGGTAACATTCCTCGAGGAATGTTACCTGGAGAACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130446.2-509s21c1
Sequence:CCGGAGACCAGTAAACCGTAGTTATCTCGAGATAACTACGGTTTACTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130446.2-427s21c1
Sequence:CCGGTGAAGTCTCATTGGATGAAAGCTCGAGCTTTCATCCAATGAGACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130446.2-377s21c1
Sequence:CCGGCAGCTCATTGATAGCGAAATACTCGAGTATTTCGCTATCAATGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001130446.2-733s21c1
Sequence:CCGGTCAAGTCATTAACGAATTATGCTCGAGCATAATTCGTTAATGACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks