EMAIL THIS PAGE TO A FRIEND

C10orf137

chromosome 10 open reading frame 137

22 Gene Product Result for
Synonyms: EDRF1
Species: Human C10orf137(26098)
Gene ID:
Human(26098) Summary: This gene may play a role in erythroid cell differentiation. The encoded protein inhibits DNA binding of the erythroid transcription factor GATA-1 and may regulate the expression of alpha-globin. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015608 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015608 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015608 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU088621 MISSION® esiRNA esiRNA human C10orf137 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015608 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015608 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021814 predicted 2188
2 SASI_Hs01_00021815 predicted 2421
3 SASI_Hs01_00021816 predicted 1228
4 SASI_Hs02_00348203 predicted 2551
5 SASI_Hs01_00021818 predicted 1035
6 SASI_Hs01_00021819 predicted 1488
7 SASI_Hs01_00021820 predicted 3041
8 SASI_Hs01_00021821 predicted 2629
9 SASI_Hs01_00021822 predicted 564
10 SASI_Hs01_00021823 predicted 2744
11 SASI_Hs01_00021817 predicted 739
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015608
C10orf137 MISSION shRNA Bacterial Glycerol Stock
chromosome 10 open reading frame 137
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015608.2-1701s1c1
Sequence:CCGGGCCAATTACATGCTTTCAGAACTCGAGTTCTGAAAGCATGTAATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144797    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015608.2-4184s1c1
Sequence:CCGGGCAGTTACACTTTCACGTATTCTCGAGAATACGTGAAAGTGTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144108    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015608.2-4224s1c1
Sequence:CCGGCACGGGTCTAAGATATGATTACTCGAGTAATCATATCTTAGACCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015608.2-3624s1c1
Sequence:CCGGCCTAGTCTCAATCGAGAAGAACTCGAGTTCTTCTCGATTGAGACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015608.2-1696s1c1
Sequence:CCGGCTTCCGCCAATTACATGCTTTCTCGAGAAAGCATGTAATTGGCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015608.2-738s1c1
Sequence:CCGGCGCATAGGAAGGACTCTCTTACTCGAGTAAGAGAGTCCTTCCTATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015608.2-985s1c1
Sequence:CCGGCGTCCAGTTCAGATCAGACAACTCGAGTTGTCTGATCTGAACTGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015608.2-3818s1c1
Sequence:CCGGCGCGACTCTTCTGGAAAGAATCTCGAGATTCTTTCCAGAAGAGTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015608.2-2979s1c1
Sequence:CCGGCCAGAAGAAGGCTTGTATTATCTCGAGATAATACAAGCCTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015608
C10orf137 MISSION shRNA shRNA Plasmid DNA
chromosome 10 open reading frame 137
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015608.2-1701s1c1
Sequence:CCGGGCCAATTACATGCTTTCAGAACTCGAGTTCTGAAAGCATGTAATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144797    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015608.2-4184s1c1
Sequence:CCGGGCAGTTACACTTTCACGTATTCTCGAGAATACGTGAAAGTGTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144108    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015608.2-4224s1c1
Sequence:CCGGCACGGGTCTAAGATATGATTACTCGAGTAATCATATCTTAGACCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015608.2-3624s1c1
Sequence:CCGGCCTAGTCTCAATCGAGAAGAACTCGAGTTCTTCTCGATTGAGACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015608.2-1696s1c1
Sequence:CCGGCTTCCGCCAATTACATGCTTTCTCGAGAAAGCATGTAATTGGCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015608.2-738s1c1
Sequence:CCGGCGCATAGGAAGGACTCTCTTACTCGAGTAAGAGAGTCCTTCCTATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015608.2-985s1c1
Sequence:CCGGCGTCCAGTTCAGATCAGACAACTCGAGTTGTCTGATCTGAACTGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015608.2-3818s1c1
Sequence:CCGGCGCGACTCTTCTGGAAAGAATCTCGAGATTCTTTCCAGAAGAGTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015608.2-2979s1c1
Sequence:CCGGCCAGAAGAAGGCTTGTATTATCTCGAGATAATACAAGCCTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015608
C10orf137 MISSION shRNA Lentiviral Transduction Particles
chromosome 10 open reading frame 137
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015608.2-1701s1c1
Sequence:CCGGGCCAATTACATGCTTTCAGAACTCGAGTTCTGAAAGCATGTAATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144797    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015608.2-4184s1c1
Sequence:CCGGGCAGTTACACTTTCACGTATTCTCGAGAATACGTGAAAGTGTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144108    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015608.2-4224s1c1
Sequence:CCGGCACGGGTCTAAGATATGATTACTCGAGTAATCATATCTTAGACCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015608.2-3624s1c1
Sequence:CCGGCCTAGTCTCAATCGAGAAGAACTCGAGTTCTTCTCGATTGAGACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015608.2-1696s1c1
Sequence:CCGGCTTCCGCCAATTACATGCTTTCTCGAGAAAGCATGTAATTGGCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015608.2-738s1c1
Sequence:CCGGCGCATAGGAAGGACTCTCTTACTCGAGTAAGAGAGTCCTTCCTATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015608.2-985s1c1
Sequence:CCGGCGTCCAGTTCAGATCAGACAACTCGAGTTGTCTGATCTGAACTGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015608.2-3818s1c1
Sequence:CCGGCGCGACTCTTCTGGAAAGAATCTCGAGATTCTTTCCAGAAGAGTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015608.2-2979s1c1
Sequence:CCGGCCAGAAGAAGGCTTGTATTATCTCGAGATAATACAAGCCTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks