EMAIL THIS PAGE TO A FRIEND

C10orf25

chromosome 10 open reading frame 25

19 Gene Product Result for
Species: Human C10orf25(220979)
UniProtKB ID: Q5T742, A1L424, Q96NM5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145022 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145022 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145022 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU097851 MISSION® esiRNA esiRNA human C10orf25 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039380 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039380 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053131 predicted 1586
2 SASI_Hs01_00053132 predicted 1373
3 SASI_Hs02_00308477 predicted 2117
4 SASI_Hs01_00053134 predicted 1797
5 SASI_Hs01_00053136 predicted 1686
6 SASI_Hs02_00308478 predicted 1885
7 SASI_Hs02_00308479 predicted 1963
8 SASI_Hs02_00308480 predicted 1888
9 SASI_Hs01_00053137 predicted 1808
10 SASI_Hs02_00308481 predicted 1382
11 SASI_Hs01_00053128 predicted 1854
12 SASI_Hs01_00053129 predicted 2112
13 SASI_Hs01_00053130 predicted 1695
14 SASI_Hs01_00053133 predicted 1861
15 SASI_Hs01_00053135 predicted 1597
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145022
C10orf25 MISSION shRNA Bacterial Glycerol Stock
chromosome 10 open reading frame 25
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145022.1-323s1c1
Sequence:CCGGCAAGGCTCAGAGAAGAAATGTCTCGAGACATTTCTTCTCTGAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149582    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145022.1-1269s1c1
Sequence:CCGGGCCTGAAGTAATACAGTGGTTCTCGAGAACCACTGTATTACTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145022.1-187s1c1
Sequence:CCGGCCAACCTAGAAACTGCATACTCTCGAGAGTATGCAGTTTCTAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147142    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145022.1-2550s1c1
Sequence:CCGGCCGTAAGAGATAGGAATTGTTCTCGAGAACAATTCCTATCTCTTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145022.1-319s1c1
Sequence:CCGGGAACCAAGGCTCAGAGAAGAACTCGAGTTCTTCTCTGAGCCTTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145022.1-332s1c1
Sequence:CCGGGAGAAGAAATGTGCTCCGTTCCTCGAGGAACGGAGCACATTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129635    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145022.1-1270s1c1
Sequence:CCGGCCTGAAGTAATACAGTGGTTTCTCGAGAAACCACTGTATTACTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129090    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145022.1-1800s1c1
Sequence:CCGGGCCAGAGGTATGTCAACTAAACTCGAGTTTAGTTGACATACCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145022
C10orf25 MISSION shRNA shRNA Plasmid DNA
chromosome 10 open reading frame 25
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145022.1-323s1c1
Sequence:CCGGCAAGGCTCAGAGAAGAAATGTCTCGAGACATTTCTTCTCTGAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149582    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145022.1-1269s1c1
Sequence:CCGGGCCTGAAGTAATACAGTGGTTCTCGAGAACCACTGTATTACTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145022.1-187s1c1
Sequence:CCGGCCAACCTAGAAACTGCATACTCTCGAGAGTATGCAGTTTCTAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147142    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145022.1-2550s1c1
Sequence:CCGGCCGTAAGAGATAGGAATTGTTCTCGAGAACAATTCCTATCTCTTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145022.1-319s1c1
Sequence:CCGGGAACCAAGGCTCAGAGAAGAACTCGAGTTCTTCTCTGAGCCTTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145022.1-332s1c1
Sequence:CCGGGAGAAGAAATGTGCTCCGTTCCTCGAGGAACGGAGCACATTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129635    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145022.1-1270s1c1
Sequence:CCGGCCTGAAGTAATACAGTGGTTTCTCGAGAAACCACTGTATTACTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129090    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145022.1-1800s1c1
Sequence:CCGGGCCAGAGGTATGTCAACTAAACTCGAGTTTAGTTGACATACCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145022
C10orf25 MISSION shRNA Lentiviral Transduction Particles
chromosome 10 open reading frame 25
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145022.1-323s1c1
Sequence:CCGGCAAGGCTCAGAGAAGAAATGTCTCGAGACATTTCTTCTCTGAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149582    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145022.1-1269s1c1
Sequence:CCGGGCCTGAAGTAATACAGTGGTTCTCGAGAACCACTGTATTACTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145022.1-187s1c1
Sequence:CCGGCCAACCTAGAAACTGCATACTCTCGAGAGTATGCAGTTTCTAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147142    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145022.1-2550s1c1
Sequence:CCGGCCGTAAGAGATAGGAATTGTTCTCGAGAACAATTCCTATCTCTTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145022.1-319s1c1
Sequence:CCGGGAACCAAGGCTCAGAGAAGAACTCGAGTTCTTCTCTGAGCCTTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145022.1-332s1c1
Sequence:CCGGGAGAAGAAATGTGCTCCGTTCCTCGAGGAACGGAGCACATTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129635    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145022.1-1270s1c1
Sequence:CCGGCCTGAAGTAATACAGTGGTTTCTCGAGAAACCACTGTATTACTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129090    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145022.1-1800s1c1
Sequence:CCGGGCCAGAGGTATGTCAACTAAACTCGAGTTTAGTTGACATACCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks