EMAIL THIS PAGE TO A FRIEND

C10orf2

chromosome 10 open reading frame 2

25 Gene Product Result for
Synonyms: ATXN8 IOSCA MTDPS7 PEO PEO1 PEOA3 SANDO SCA8 TWINL
Species: Human C10orf2(56652)
Gene ID:
Human(56652) Summary: This gene encodes a hexameric DNA helicase which unwinds short stretches of double-stranded DNA in the 5' to 3' direction and, along with mitochondrial single-stranded DNA binding protein and mtDNA polymerase gamma, is thought to play a key role in mtDNA replication. The protein localizes to the mitochondrial matrix and mitochondrial nucleoids. Mutations in this gene cause infantile onset spinocerebellar ataxia (IOSCA) and progressive external ophthalmoplegia (PEO) and are also associated with several mitochondrial depletion syndromes. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Aug 2009]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021830 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021830 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021830 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU005451 MISSION® esiRNA esiRNA targeting human PEO1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021830 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021830 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223373 predicted 2455
2 SASI_Hs01_00223374 predicted 1178
3 SASI_Hs01_00223375 predicted 2294
4 SASI_Hs01_00223376 predicted 1384
5 SASI_Hs01_00223377 predicted 1910
6 SASI_Hs01_00223378 predicted 1830
7 SASI_Hs02_00355145 predicted 975
8 SASI_Hs01_00223379 predicted 1701
9 SASI_Hs01_00223380 predicted 2479
10 SASI_Hs01_00223381 predicted 818
11 SASI_Hs01_00223382 predicted 1985
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021830
VALIDATED
C10orf2 MISSION shRNA Bacterial Glycerol Stock
chromosome 10 open reading frame 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082993    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_021830.3-2903s1c1
Sequence:CCGGGCTTTGTTTGAGGTCCTGTATCTCGAGATACAGGACCTCAAACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_021830.3-2507s1c1
Sequence:CCGGCCCGCTTGAGTTCAACAAGAACTCGAGTTCTTGTTGAACTCAAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021830.3-825s1c1
Sequence:CCGGGCAACTGAAATCCGCCAGTATCTCGAGATACTGGCGGATTTCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_021830.3-2166s1c1
Sequence:CCGGGCAGTCTACGTCTATGACATTCTCGAGAATGTCATAGACGTAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_021830.3-1407s1c1
Sequence:CCGGCCACTGATTAGTCGTCGAGATCTCGAGATCTCGACGACTAATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021830.3-1228s21c1
Sequence:CCGGAGCGTTTCAGTGTGCGATATCCTCGAGGATATCGCACACTGAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290459    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_021830.3-2903s21c1
Sequence:CCGGGCTTTGTTTGAGGTCCTGTATCTCGAGATACAGGACCTCAAACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021830.3-1123s21c1
Sequence:CCGGGGATCTGGAACCGAGCAATACCTCGAGGTATTGCTCGGTTCCAGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_021830.3-1694s21c1
Sequence:CCGGGAACGGAGGCTTCAATCTTTCCTCGAGGAAAGATTGAAGCCTCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021830.3-1173s21c1
Sequence:CCGGGTTCAGCTGGCTGATACAATGCTCGAGCATTGTATCAGCCAGCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021830
VALIDATED
C10orf2 MISSION shRNA shRNA Plasmid DNA
chromosome 10 open reading frame 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082993    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_021830.3-2903s1c1
Sequence:CCGGGCTTTGTTTGAGGTCCTGTATCTCGAGATACAGGACCTCAAACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_021830.3-2507s1c1
Sequence:CCGGCCCGCTTGAGTTCAACAAGAACTCGAGTTCTTGTTGAACTCAAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021830.3-825s1c1
Sequence:CCGGGCAACTGAAATCCGCCAGTATCTCGAGATACTGGCGGATTTCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_021830.3-2166s1c1
Sequence:CCGGGCAGTCTACGTCTATGACATTCTCGAGAATGTCATAGACGTAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_021830.3-1407s1c1
Sequence:CCGGCCACTGATTAGTCGTCGAGATCTCGAGATCTCGACGACTAATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021830.3-1228s21c1
Sequence:CCGGAGCGTTTCAGTGTGCGATATCCTCGAGGATATCGCACACTGAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290459    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_021830.3-2903s21c1
Sequence:CCGGGCTTTGTTTGAGGTCCTGTATCTCGAGATACAGGACCTCAAACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021830.3-1123s21c1
Sequence:CCGGGGATCTGGAACCGAGCAATACCTCGAGGTATTGCTCGGTTCCAGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_021830.3-1694s21c1
Sequence:CCGGGAACGGAGGCTTCAATCTTTCCTCGAGGAAAGATTGAAGCCTCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021830.3-1173s21c1
Sequence:CCGGGTTCAGCTGGCTGATACAATGCTCGAGCATTGTATCAGCCAGCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021830
VALIDATED
C10orf2 MISSION shRNA Lentiviral Transduction Particles
chromosome 10 open reading frame 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082993    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_021830.3-2903s1c1
Sequence:CCGGGCTTTGTTTGAGGTCCTGTATCTCGAGATACAGGACCTCAAACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_021830.3-2507s1c1
Sequence:CCGGCCCGCTTGAGTTCAACAAGAACTCGAGTTCTTGTTGAACTCAAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021830.3-825s1c1
Sequence:CCGGGCAACTGAAATCCGCCAGTATCTCGAGATACTGGCGGATTTCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_021830.3-2166s1c1
Sequence:CCGGGCAGTCTACGTCTATGACATTCTCGAGAATGTCATAGACGTAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_021830.3-1407s1c1
Sequence:CCGGCCACTGATTAGTCGTCGAGATCTCGAGATCTCGACGACTAATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021830.3-1228s21c1
Sequence:CCGGAGCGTTTCAGTGTGCGATATCCTCGAGGATATCGCACACTGAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290459    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_021830.3-2903s21c1
Sequence:CCGGGCTTTGTTTGAGGTCCTGTATCTCGAGATACAGGACCTCAAACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021830.3-1123s21c1
Sequence:CCGGGGATCTGGAACCGAGCAATACCTCGAGGTATTGCTCGGTTCCAGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_021830.3-1694s21c1
Sequence:CCGGGAACGGAGGCTTCAATCTTTCCTCGAGGAAAGATTGAAGCCTCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021830.3-1173s21c1
Sequence:CCGGGTTCAGCTGGCTGATACAATGCTCGAGCATTGTATCAGCCAGCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks