EMAIL THIS PAGE TO A FRIEND

C10orf32

chromosome 10 open reading frame 32

40 Gene Product Result for
Synonyms: RP11-753C18.6
Species: Human C10orf32(119032)
UniProtKB ID: Q96B45, B2R488, B3KUW4, C9K0X3
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA037648 Anti-BORCS7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144591 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144591 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144591 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU135481 MISSION® esiRNA esiRNA human C10orf32 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144591 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144591 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015268 predicted 202
2 SASI_Hs01_00015269 predicted 273
3 SASI_Hs01_00015270 predicted 333
4 SASI_Hs01_00015271 predicted 305
5 SASI_Hs01_00015272 predicted 236
6 SASI_Hs01_00015273 predicted 321
7 SASI_Hs01_00015274 predicted 583
8 SASI_Hs01_00015275 predicted 600
9 SASI_Hs01_00015276 predicted 223
10 SASI_Hs01_00015277 predicted 327
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144591
C10orf32 MISSION shRNA Bacterial Glycerol Stock
chromosome 10 open reading frame 32
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130339    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144591.1-567s1c1
Sequence:CCGGGCCAAATATGAAGGCAGTTGACTCGAGTCAACTGCCTTCATATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144591.1-278s1c1
Sequence:CCGGGCAAGAAGCTATTCAGAAGAACTCGAGTTCTTCTGAATAGCTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144591.1-213s1c1
Sequence:CCGGGCCATCTTGCACTCAGAAGATCTCGAGATCTTCTGAGTGCAAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144591.1-315s1c1
Sequence:CCGGGATCTACAGGACCAGTTGAATCTCGAGATTCAACTGGTCCTGTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144591.1-554s1c1
Sequence:CCGGGCATGACGTTACTGCCAAATACTCGAGTATTTGGCAGTAACGTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144591.1-326s1c1
Sequence:CCGGCCAGTTGAATCATCTGTTGAACTCGAGTTCAACAGATGATTCAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144591.3-459s21c1
Sequence:CCGGATTAGGCAAGTGGTATCATTACTCGAGTAATGATACCACTTGCCTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144591.3-735s21c1
Sequence:CCGGGTCTGTTGTCAAACCTAAATACTCGAGTATTTAGGTTTGACAACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144591.3-874s21c1
Sequence:CCGGAGTAACAGTGAATCCAATATACTCGAGTATATTGGATTCACTGTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144591
C10orf32 MISSION shRNA shRNA Plasmid DNA
chromosome 10 open reading frame 32
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130339    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144591.1-567s1c1
Sequence:CCGGGCCAAATATGAAGGCAGTTGACTCGAGTCAACTGCCTTCATATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144591.1-278s1c1
Sequence:CCGGGCAAGAAGCTATTCAGAAGAACTCGAGTTCTTCTGAATAGCTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144591.1-213s1c1
Sequence:CCGGGCCATCTTGCACTCAGAAGATCTCGAGATCTTCTGAGTGCAAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144591.1-315s1c1
Sequence:CCGGGATCTACAGGACCAGTTGAATCTCGAGATTCAACTGGTCCTGTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144591.1-554s1c1
Sequence:CCGGGCATGACGTTACTGCCAAATACTCGAGTATTTGGCAGTAACGTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144591.1-326s1c1
Sequence:CCGGCCAGTTGAATCATCTGTTGAACTCGAGTTCAACAGATGATTCAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144591.3-459s21c1
Sequence:CCGGATTAGGCAAGTGGTATCATTACTCGAGTAATGATACCACTTGCCTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144591.3-735s21c1
Sequence:CCGGGTCTGTTGTCAAACCTAAATACTCGAGTATTTAGGTTTGACAACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144591.3-874s21c1
Sequence:CCGGAGTAACAGTGAATCCAATATACTCGAGTATATTGGATTCACTGTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144591
C10orf32 MISSION shRNA Lentiviral Transduction Particles
chromosome 10 open reading frame 32
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130339    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144591.1-567s1c1
Sequence:CCGGGCCAAATATGAAGGCAGTTGACTCGAGTCAACTGCCTTCATATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144591.1-278s1c1
Sequence:CCGGGCAAGAAGCTATTCAGAAGAACTCGAGTTCTTCTGAATAGCTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144591.1-213s1c1
Sequence:CCGGGCCATCTTGCACTCAGAAGATCTCGAGATCTTCTGAGTGCAAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144591.1-315s1c1
Sequence:CCGGGATCTACAGGACCAGTTGAATCTCGAGATTCAACTGGTCCTGTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144591.1-554s1c1
Sequence:CCGGGCATGACGTTACTGCCAAATACTCGAGTATTTGGCAGTAACGTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144591.1-326s1c1
Sequence:CCGGCCAGTTGAATCATCTGTTGAACTCGAGTTCAACAGATGATTCAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144591.3-459s21c1
Sequence:CCGGATTAGGCAAGTGGTATCATTACTCGAGTAATGATACCACTTGCCTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144591.3-735s21c1
Sequence:CCGGGTCTGTTGTCAAACCTAAATACTCGAGTATTTAGGTTTGACAACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144591.3-874s21c1
Sequence:CCGGAGTAACAGTGAATCCAATATACTCGAGTATATTGGATTCACTGTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks