EMAIL THIS PAGE TO A FRIEND

C10orf35

chromosome 10 open reading frame 35

49 Gene Product Result for
Species: Human C10orf35(219738)
UniProtKB ID: Q96D05
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145306 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145306 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145306 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU153481 MISSION® esiRNA esiRNA human C10orf35 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145306 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145306 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365201 predicted 247
2 SASI_Hs02_00365202 predicted 398
3 SASI_Hs01_00197988 predicted 246
4 SASI_Hs01_00197989 predicted 244
5 SASI_Hs02_00365203 predicted 392
6 SASI_Hs02_00365204 predicted 489
7 SASI_Hs02_00365205 predicted 397
8 SASI_Hs01_00197993 predicted 237
9 SASI_Hs01_00197995 predicted 459
10 SASI_Hs01_00197996 predicted 416
11 SASI_Hs01_00197987 predicted 247
12 SASI_Hs01_00197990 predicted 250
13 SASI_Hs01_00197991 predicted 253
14 SASI_Hs01_00197992 predicted 236
15 SASI_Hs01_00197994 predicted 385
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145306
VALIDATED
C10orf35 MISSION shRNA Bacterial Glycerol Stock
chromosome 10 open reading frame 35
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145306.2-533s21c1
Sequence:CCGGGTGACCTCTGAGGGCTGATAGCTCGAGCTATCAGCCCTCAGAGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241716    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145306.2-588s21c1
Sequence:CCGGGGTGTGAGAGCAGGCATATTTCTCGAGAAATATGCCTGCTCTCACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145306.1-442s1c1
Sequence:CCGGCTCTTCCTGCTCATGATGCTTCTCGAGAAGCATCATGAGCAGGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145306.2-238s21c1
Sequence:CCGGAGCCACCAAGAGGTAGCATTCCTCGAGGAATGCTACCTCTTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145306.2-379s21c1
Sequence:CCGGAGCTGGTGAACATGGGCTTTCCTCGAGGAAAGCCCATGTTCACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145306.2-260s21c1
Sequence:CCGGTCGACAGAGCTTCTTCAACAGCTCGAGCTGTTGAAGAAGCTCTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145306.1-610s1c1
Sequence:CCGGGTGGTGCCTTGAAGGTATGATCTCGAGATCATACCTTCAAGGCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145306.1-248s1c1
Sequence:CCGGCTCGACAGAGCTTCTTCAATACTCGAGTATTGAAGAAGCTCTGTCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145306.1-250s1c2
Sequence:CCGGCGACAGAGCTTCTTCAATAGGCTCGAGCCTATTGAAGAAGCTCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145306
VALIDATED
C10orf35 MISSION shRNA shRNA Plasmid DNA
chromosome 10 open reading frame 35
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145306.2-533s21c1
Sequence:CCGGGTGACCTCTGAGGGCTGATAGCTCGAGCTATCAGCCCTCAGAGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241716    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145306.2-588s21c1
Sequence:CCGGGGTGTGAGAGCAGGCATATTTCTCGAGAAATATGCCTGCTCTCACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145306.1-442s1c1
Sequence:CCGGCTCTTCCTGCTCATGATGCTTCTCGAGAAGCATCATGAGCAGGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145306.2-238s21c1
Sequence:CCGGAGCCACCAAGAGGTAGCATTCCTCGAGGAATGCTACCTCTTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145306.2-379s21c1
Sequence:CCGGAGCTGGTGAACATGGGCTTTCCTCGAGGAAAGCCCATGTTCACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145306.2-260s21c1
Sequence:CCGGTCGACAGAGCTTCTTCAACAGCTCGAGCTGTTGAAGAAGCTCTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145306.1-610s1c1
Sequence:CCGGGTGGTGCCTTGAAGGTATGATCTCGAGATCATACCTTCAAGGCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145306.1-248s1c1
Sequence:CCGGCTCGACAGAGCTTCTTCAATACTCGAGTATTGAAGAAGCTCTGTCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145306.1-250s1c2
Sequence:CCGGCGACAGAGCTTCTTCAATAGGCTCGAGCCTATTGAAGAAGCTCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145306
VALIDATED
C10orf35 MISSION shRNA Lentiviral Transduction Particles
chromosome 10 open reading frame 35
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145306.2-533s21c1
Sequence:CCGGGTGACCTCTGAGGGCTGATAGCTCGAGCTATCAGCCCTCAGAGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241716    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145306.2-588s21c1
Sequence:CCGGGGTGTGAGAGCAGGCATATTTCTCGAGAAATATGCCTGCTCTCACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145306.1-442s1c1
Sequence:CCGGCTCTTCCTGCTCATGATGCTTCTCGAGAAGCATCATGAGCAGGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145306.2-238s21c1
Sequence:CCGGAGCCACCAAGAGGTAGCATTCCTCGAGGAATGCTACCTCTTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145306.2-379s21c1
Sequence:CCGGAGCTGGTGAACATGGGCTTTCCTCGAGGAAAGCCCATGTTCACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145306.2-260s21c1
Sequence:CCGGTCGACAGAGCTTCTTCAACAGCTCGAGCTGTTGAAGAAGCTCTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145306.1-610s1c1
Sequence:CCGGGTGGTGCCTTGAAGGTATGATCTCGAGATCATACCTTCAAGGCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145306.1-248s1c1
Sequence:CCGGCTCGACAGAGCTTCTTCAATACTCGAGTATTGAAGAAGCTCTGTCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145306.1-250s1c2
Sequence:CCGGCGACAGAGCTTCTTCAATAGGCTCGAGCCTATTGAAGAAGCTCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks