EMAIL THIS PAGE TO A FRIEND

C10orf53

chromosome 10 open reading frame 53

34 Gene Product Result for
Species: Human C10orf53(282966)
UniProtKB ID: Q8N6V4, A6NI81, A6NLE0, B9ZVK6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA037951 Anti-C10orf53 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182554 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182554 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182554 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042427 Rosetta Predictions human pricing
NM_182554 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042427 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309708 predicted 264
2 SASI_Hs02_00309709 predicted 330
3 SASI_Hs02_00309710 predicted 228
4 SASI_Hs02_00309711 predicted 204
5 SASI_Hs02_00309712 predicted 265
6 SASI_Hs02_00309713 predicted 357
7 SASI_Hs02_00309714 predicted 247
8 SASI_Hs02_00309715 predicted 289
9 SASI_Hs02_00309716 predicted 263
10 SASI_Hs02_00309717 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182554 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120579 predicted 735
2 SASI_Hs01_00120580 predicted 709
3 SASI_Hs02_00370671 predicted 715
4 SASI_Hs02_00370672 predicted 237
5 SASI_Hs02_00370673 predicted 737
6 SASI_Hs02_00370674 predicted 168
7 SASI_Hs02_00370675 predicted 205
8 SASI_Hs02_00370676 predicted 752
9 SASI_Hs02_00370677 predicted 71
10 SASI_Hs02_00370678 predicted 685
11 SASI_Hs01_00120572 predicted 869
12 SASI_Hs01_00120573 predicted 803
13 SASI_Hs01_00120574 predicted 971
14 SASI_Hs01_00120575 predicted 977
15 SASI_Hs01_00120576 predicted 851
16 SASI_Hs01_00120577 predicted 853
17 SASI_Hs01_00120578 predicted 922
18 SASI_Hs01_00120581 predicted 633
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182554
C10orf53 MISSION shRNA Bacterial Glycerol Stock
chromosome 10 open reading frame 53
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182554.1-404s1c1
Sequence:CCGGCCAATCTTTGTGACCTGGGTTCTCGAGAACCCAGGTCACAAAGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182554.1-838s1c1
Sequence:CCGGCCCAAGCTGTTTAACTGGATTCTCGAGAATCCAGTTAAACAGCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182554.1-323s1c1
Sequence:CCGGCTTTGCAACAGTTCCCACAAACTCGAGTTTGTGGGAACTGTTGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182554.1-177s1c1
Sequence:CCGGCATGGTGAATGAAGAAGTCATCTCGAGATGACTTCTTCATTCACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182554.1-207s1c1
Sequence:CCGGCAACATTAAGGACTTGGAGTTCTCGAGAACTCCAAGTCCTTAATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437637    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182554.2-656s21c1
Sequence:CCGGCGAACCTCTCCAGCTAGATGTCTCGAGACATCTAGCTGGAGAGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182554.2-532s21c1
Sequence:CCGGTGAAATCGACAGGACAGATTGCTCGAGCAATCTGTCCTGTCGATTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182554.2-410s21c1
Sequence:CCGGGTACTGTATTGGCCCAGATTGCTCGAGCAATCTGGGCCAATACAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182554
C10orf53 MISSION shRNA shRNA Plasmid DNA
chromosome 10 open reading frame 53
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182554.1-404s1c1
Sequence:CCGGCCAATCTTTGTGACCTGGGTTCTCGAGAACCCAGGTCACAAAGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182554.1-838s1c1
Sequence:CCGGCCCAAGCTGTTTAACTGGATTCTCGAGAATCCAGTTAAACAGCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182554.1-323s1c1
Sequence:CCGGCTTTGCAACAGTTCCCACAAACTCGAGTTTGTGGGAACTGTTGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182554.1-177s1c1
Sequence:CCGGCATGGTGAATGAAGAAGTCATCTCGAGATGACTTCTTCATTCACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182554.1-207s1c1
Sequence:CCGGCAACATTAAGGACTTGGAGTTCTCGAGAACTCCAAGTCCTTAATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437637    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182554.2-656s21c1
Sequence:CCGGCGAACCTCTCCAGCTAGATGTCTCGAGACATCTAGCTGGAGAGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182554.2-532s21c1
Sequence:CCGGTGAAATCGACAGGACAGATTGCTCGAGCAATCTGTCCTGTCGATTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182554.2-410s21c1
Sequence:CCGGGTACTGTATTGGCCCAGATTGCTCGAGCAATCTGGGCCAATACAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182554
C10orf53 MISSION shRNA Lentiviral Transduction Particles
chromosome 10 open reading frame 53
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182554.1-404s1c1
Sequence:CCGGCCAATCTTTGTGACCTGGGTTCTCGAGAACCCAGGTCACAAAGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182554.1-838s1c1
Sequence:CCGGCCCAAGCTGTTTAACTGGATTCTCGAGAATCCAGTTAAACAGCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182554.1-323s1c1
Sequence:CCGGCTTTGCAACAGTTCCCACAAACTCGAGTTTGTGGGAACTGTTGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182554.1-177s1c1
Sequence:CCGGCATGGTGAATGAAGAAGTCATCTCGAGATGACTTCTTCATTCACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182554.1-207s1c1
Sequence:CCGGCAACATTAAGGACTTGGAGTTCTCGAGAACTCCAAGTCCTTAATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437637    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182554.2-656s21c1
Sequence:CCGGCGAACCTCTCCAGCTAGATGTCTCGAGACATCTAGCTGGAGAGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182554.2-532s21c1
Sequence:CCGGTGAAATCGACAGGACAGATTGCTCGAGCAATCTGTCCTGTCGATTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182554.2-410s21c1
Sequence:CCGGGTACTGTATTGGCCCAGATTGCTCGAGCAATCTGGGCCAATACAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks