EMAIL THIS PAGE TO A FRIEND

C10orf54

chromosome 10 open reading frame 54

25 Gene Product Result for
Synonyms: B7-H5 B7H5 GI24 PP2135 SISP1
UniProtKB ID: Q9H7M9, A8MVH5, Q6UXF3, Q8WUG3, Q8WYZ8
Gene ID:
chicken(769500) chromosome 6 open reading frame, human C10orf54
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022153 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022153 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022153 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU140791 MISSION® esiRNA esiRNA human C10orf54 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022153 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022153 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355572 predicted 1359
2 SASI_Hs01_00014755 predicted 1133
3 SASI_Hs01_00014756 predicted 247
4 SASI_Hs01_00014757 predicted 1381
5 SASI_Hs01_00014758 predicted 1383
6 SASI_Hs01_00014759 predicted 321
7 SASI_Hs01_00014760 predicted 1544
8 SASI_Hs01_00014761 predicted 1315
9 SASI_Hs01_00014762 predicted 1341
10 SASI_Hs01_00014763 predicted 1048
11 SASI_Hs01_00014764 predicted 846
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022153
C10orf54 MISSION shRNA Bacterial Glycerol Stock
chromosome 10 open reading frame 54
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142397    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022153.1-2026s1c1
Sequence:CCGGGATGGATTGTAAGAGCCAGTTCTCGAGAACTGGCTCTTACAATCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022153.1-1055s1c1
Sequence:CCGGCTCCAAACTTTGAGGTCATCTCTCGAGAGATGACCTCAAAGTTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022153.1-253s1c1
Sequence:CCGGCCGTATTCCCTGTATGTCTGTCTCGAGACAGACATACAGGGAATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022153.1-835s1c1
Sequence:CCGGCGGATGGACAGCAACATTCAACTCGAGTTGAATGTTGCTGTCCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022153.1-1047s1c1
Sequence:CCGGCCCTGACTCTCCAAACTTTGACTCGAGTCAAAGTTTGGAGAGTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022153.1-1327s1c1
Sequence:CCGGCACCAGCTACAGATGCCAAATCTCGAGATTTGGCATCTGTAGCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139888    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022153.1-1763s1c1
Sequence:CCGGGCAAATGGTGTCTTGGGCAATCTCGAGATTGCCCAAGACACCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022153.1-653s1c1
Sequence:CCGGGCAAAGATGCACCATCCAACTCTCGAGAGTTGGATGGTGCATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140372    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022153.1-330s1c1
Sequence:CCGGGCACGATGTGACCTTCTACAACTCGAGTTGTAGAAGGTCACATCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022153.1-3220s1c1
Sequence:CCGGGCAGAGACAACTTCTAAGAATCTCGAGATTCTTAGAAGTTGTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022153
C10orf54 MISSION shRNA shRNA Plasmid DNA
chromosome 10 open reading frame 54
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142397    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022153.1-2026s1c1
Sequence:CCGGGATGGATTGTAAGAGCCAGTTCTCGAGAACTGGCTCTTACAATCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022153.1-1055s1c1
Sequence:CCGGCTCCAAACTTTGAGGTCATCTCTCGAGAGATGACCTCAAAGTTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022153.1-253s1c1
Sequence:CCGGCCGTATTCCCTGTATGTCTGTCTCGAGACAGACATACAGGGAATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022153.1-835s1c1
Sequence:CCGGCGGATGGACAGCAACATTCAACTCGAGTTGAATGTTGCTGTCCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022153.1-1047s1c1
Sequence:CCGGCCCTGACTCTCCAAACTTTGACTCGAGTCAAAGTTTGGAGAGTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022153.1-1327s1c1
Sequence:CCGGCACCAGCTACAGATGCCAAATCTCGAGATTTGGCATCTGTAGCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139888    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022153.1-1763s1c1
Sequence:CCGGGCAAATGGTGTCTTGGGCAATCTCGAGATTGCCCAAGACACCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022153.1-653s1c1
Sequence:CCGGGCAAAGATGCACCATCCAACTCTCGAGAGTTGGATGGTGCATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140372    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022153.1-330s1c1
Sequence:CCGGGCACGATGTGACCTTCTACAACTCGAGTTGTAGAAGGTCACATCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022153.1-3220s1c1
Sequence:CCGGGCAGAGACAACTTCTAAGAATCTCGAGATTCTTAGAAGTTGTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022153
C10orf54 MISSION shRNA Lentiviral Transduction Particles
chromosome 10 open reading frame 54
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142397    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022153.1-2026s1c1
Sequence:CCGGGATGGATTGTAAGAGCCAGTTCTCGAGAACTGGCTCTTACAATCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022153.1-1055s1c1
Sequence:CCGGCTCCAAACTTTGAGGTCATCTCTCGAGAGATGACCTCAAAGTTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022153.1-253s1c1
Sequence:CCGGCCGTATTCCCTGTATGTCTGTCTCGAGACAGACATACAGGGAATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022153.1-835s1c1
Sequence:CCGGCGGATGGACAGCAACATTCAACTCGAGTTGAATGTTGCTGTCCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022153.1-1047s1c1
Sequence:CCGGCCCTGACTCTCCAAACTTTGACTCGAGTCAAAGTTTGGAGAGTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022153.1-1327s1c1
Sequence:CCGGCACCAGCTACAGATGCCAAATCTCGAGATTTGGCATCTGTAGCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139888    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022153.1-1763s1c1
Sequence:CCGGGCAAATGGTGTCTTGGGCAATCTCGAGATTGCCCAAGACACCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022153.1-653s1c1
Sequence:CCGGGCAAAGATGCACCATCCAACTCTCGAGAGTTGGATGGTGCATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140372    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022153.1-330s1c1
Sequence:CCGGGCACGATGTGACCTTCTACAACTCGAGTTGTAGAAGGTCACATCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022153.1-3220s1c1
Sequence:CCGGGCAGAGACAACTTCTAAGAATCTCGAGATTCTTAGAAGTTGTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks