EMAIL THIS PAGE TO A FRIEND

C10orf55

chromosome 10 open reading frame 55

Synonyms: bA417O11.3
Species: Human C10orf55(414236)
UniProtKB ID: Q5SWW7, Q3KRG4, Q8NAK4
Gene ID:
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA045739 Anti-C10orf55 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001791 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001791 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001791 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU231621 MISSION® esiRNA esiRNA targeting human C10orf55 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001791 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001791 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146853 predicted 197
2 SASI_Hs01_00146854 predicted 500
3 SASI_Hs01_00146855 predicted 192
4 SASI_Hs01_00146856 predicted 507
5 SASI_Hs01_00146857 predicted 235
6 SASI_Hs01_00146858 predicted 579
7 SASI_Hs01_00146859 predicted 263
8 SASI_Hs01_00146860 predicted 498
9 SASI_Hs01_00146861 predicted 268
10 SASI_Hs02_00303943 predicted 387
11 SASI_Hs01_00146852 predicted 232
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001791
C10orf55 MISSION shRNA Bacterial Glycerol Stock
chromosome 10 open reading frame 55
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172265    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001791.1-1436s1c1
Sequence:CCGGCGCGACAAATGTACGAGACATCTCGAGATGTCTCGTACATTTGTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001791.1-1696s21c1
Sequence:CCGGTTGGGTTAGGTGTCGTGATATCTCGAGATATCACGACACCTAACCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001791.1-206s21c1
Sequence:CCGGTTCGTATCTAGTTCTCAAATGCTCGAGCATTTGAGAACTAGATACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001791.1-136s21c1
Sequence:CCGGACTCCAGGGTGAGGGTAAACTCTCGAGAGTTTACCCTCACCCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001791.1-268s21c1
Sequence:CCGGAGCAAGCTTCATCTACCAGATCTCGAGATCTGGTAGATGAAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001791.1-98s21c1
Sequence:CCGGTCGGGAGGAGGCTTCATCAAACTCGAGTTTGATGAAGCCTCCTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001791
C10orf55 MISSION shRNA shRNA Plasmid DNA
chromosome 10 open reading frame 55
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172265    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001791.1-1436s1c1
Sequence:CCGGCGCGACAAATGTACGAGACATCTCGAGATGTCTCGTACATTTGTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001791.1-1696s21c1
Sequence:CCGGTTGGGTTAGGTGTCGTGATATCTCGAGATATCACGACACCTAACCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001791.1-206s21c1
Sequence:CCGGTTCGTATCTAGTTCTCAAATGCTCGAGCATTTGAGAACTAGATACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001791.1-136s21c1
Sequence:CCGGACTCCAGGGTGAGGGTAAACTCTCGAGAGTTTACCCTCACCCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001791.1-268s21c1
Sequence:CCGGAGCAAGCTTCATCTACCAGATCTCGAGATCTGGTAGATGAAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001791.1-98s21c1
Sequence:CCGGTCGGGAGGAGGCTTCATCAAACTCGAGTTTGATGAAGCCTCCTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001791
C10orf55 MISSION shRNA Lentiviral Transduction Particles
chromosome 10 open reading frame 55
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172265    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001791.1-1436s1c1
Sequence:CCGGCGCGACAAATGTACGAGACATCTCGAGATGTCTCGTACATTTGTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001791.1-1696s21c1
Sequence:CCGGTTGGGTTAGGTGTCGTGATATCTCGAGATATCACGACACCTAACCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001791.1-206s21c1
Sequence:CCGGTTCGTATCTAGTTCTCAAATGCTCGAGCATTTGAGAACTAGATACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001791.1-136s21c1
Sequence:CCGGACTCCAGGGTGAGGGTAAACTCTCGAGAGTTTACCCTCACCCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001791.1-268s21c1
Sequence:CCGGAGCAAGCTTCATCTACCAGATCTCGAGATCTGGTAGATGAAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001791.1-98s21c1
Sequence:CCGGTCGGGAGGAGGCTTCATCAAACTCGAGTTTGATGAAGCCTCCTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks