EMAIL THIS PAGE TO A FRIEND

C10orf62

chromosome 10 open reading frame 62

34 Gene Product Result for
Synonyms: bA548K23.1
Species: Human C10orf62(414157)
UniProtKB ID: Q5T681, Q49A70, Q8N3Y6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001009997 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001009997 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001009997 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU103621 MISSION® esiRNA esiRNA human C10orf62 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009997 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009997 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305774 predicted 906
2 SASI_Hs01_00208544 predicted 382
3 SASI_Hs02_00305775 predicted 614
4 SASI_Hs01_00208545 predicted 413
5 SASI_Hs01_00208546 predicted 208
6 SASI_Hs01_00208547 predicted 733
7 SASI_Hs01_00208548 predicted 754
8 SASI_Hs01_00208549 predicted 748
9 SASI_Hs01_00208550 predicted 278
10 SASI_Hs01_00208551 predicted 486
11 SASI_Hs01_00208552 predicted 835
12 SASI_Hs01_00208553 predicted 344
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001009997
C10orf62 MISSION shRNA Bacterial Glycerol Stock
chromosome 10 open reading frame 62
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009997.1-826s21c1
Sequence:CCGGCCTAATCGCAGACACTAGATCCTCGAGGATCTAGTGTCTGCGATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009997.1-236s21c1
Sequence:CCGGAGTCACCAGAATCCCATAAAGCTCGAGCTTTATGGGATTCTGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009997.1-377s21c1
Sequence:CCGGTCAGCTCCACGGTTCACATAGCTCGAGCTATGTGAACCGTGGAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000270330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009997.1-269s21c1
Sequence:CCGGGCTGGATTAAATCCCACTTTACTCGAGTAAAGTGGGATTTAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001009997.1-968s21c1
Sequence:CCGGTGTGCCCAAATCCCTACTTTCCTCGAGGAAAGTAGGGATTTGGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009997.1-232s1c1
Sequence:CCGGGACAAGTCACCAGAATCCCATCTCGAGATGGGATTCTGGTGACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009997.1-384s1c1
Sequence:CCGGCACGGTTCACATAGAGACCTTCTCGAGAAGGTCTCTATGTGAACCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009997.1-244s1c1
Sequence:CCGGGAATCCCATAAAGCAAAGAATCTCGAGATTCTTTGCTTTATGGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001009997
C10orf62 MISSION shRNA shRNA Plasmid DNA
chromosome 10 open reading frame 62
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009997.1-826s21c1
Sequence:CCGGCCTAATCGCAGACACTAGATCCTCGAGGATCTAGTGTCTGCGATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009997.1-236s21c1
Sequence:CCGGAGTCACCAGAATCCCATAAAGCTCGAGCTTTATGGGATTCTGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009997.1-377s21c1
Sequence:CCGGTCAGCTCCACGGTTCACATAGCTCGAGCTATGTGAACCGTGGAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000270330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009997.1-269s21c1
Sequence:CCGGGCTGGATTAAATCCCACTTTACTCGAGTAAAGTGGGATTTAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001009997.1-968s21c1
Sequence:CCGGTGTGCCCAAATCCCTACTTTCCTCGAGGAAAGTAGGGATTTGGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009997.1-232s1c1
Sequence:CCGGGACAAGTCACCAGAATCCCATCTCGAGATGGGATTCTGGTGACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009997.1-384s1c1
Sequence:CCGGCACGGTTCACATAGAGACCTTCTCGAGAAGGTCTCTATGTGAACCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009997.1-244s1c1
Sequence:CCGGGAATCCCATAAAGCAAAGAATCTCGAGATTCTTTGCTTTATGGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001009997
C10orf62 MISSION shRNA Lentiviral Transduction Particles
chromosome 10 open reading frame 62
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009997.1-826s21c1
Sequence:CCGGCCTAATCGCAGACACTAGATCCTCGAGGATCTAGTGTCTGCGATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009997.1-236s21c1
Sequence:CCGGAGTCACCAGAATCCCATAAAGCTCGAGCTTTATGGGATTCTGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009997.1-377s21c1
Sequence:CCGGTCAGCTCCACGGTTCACATAGCTCGAGCTATGTGAACCGTGGAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000270330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009997.1-269s21c1
Sequence:CCGGGCTGGATTAAATCCCACTTTACTCGAGTAAAGTGGGATTTAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001009997.1-968s21c1
Sequence:CCGGTGTGCCCAAATCCCTACTTTCCTCGAGGAAAGTAGGGATTTGGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009997.1-232s1c1
Sequence:CCGGGACAAGTCACCAGAATCCCATCTCGAGATGGGATTCTGGTGACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009997.1-384s1c1
Sequence:CCGGCACGGTTCACATAGAGACCTTCTCGAGAAGGTCTCTATGTGAACCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009997.1-244s1c1
Sequence:CCGGGAATCCCATAAAGCAAAGAATCTCGAGATTCTTTGCTTTATGGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks