EMAIL THIS PAGE TO A FRIEND

C10orf67

chromosome 10 open reading frame 67

20 Gene Product Result for
Species: Human C10orf67(256815)
UniProtKB ID: Q8IYJ2, A8MUP9, Q5SWD4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153714 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153714 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153714 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU022861 MISSION® esiRNA esiRNA human C10orf67 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153714 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153714 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106177 predicted 251
2 SASI_Hs01_00106178 predicted 262
3 SASI_Hs01_00106180 predicted 314
4 SASI_Hs02_00367442 predicted 341
5 SASI_Hs01_00106181 predicted 222
6 SASI_Hs01_00106182 predicted 395
7 SASI_Hs01_00106183 predicted 261
8 SASI_Hs01_00106184 predicted 318
9 SASI_Hs01_00106185 predicted 333
10 SASI_Hs01_00106186 predicted 313
11 SASI_Hs01_00106179 predicted 323
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153714
C10orf67 MISSION shRNA Bacterial Glycerol Stock
chromosome 10 open reading frame 67
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153714.1-588s1c1
Sequence:CCGGCATAGCTGTTATCAAAGGAATCTCGAGATTCCTTTGATAACAGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153714.1-529s1c1
Sequence:CCGGCATTATCAACAGAATGAGGATCTCGAGATCCTCATTCTGTTGATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153714.1-1494s1c1
Sequence:CCGGGCCTTAAACTTCTGGACTCAACTCGAGTTGAGTCCAGAAGTTTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153714.2-101s21c1
Sequence:CCGGATGTCATGAGCATAGTTATTACTCGAGTAATAACTATGCTCATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263841    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153714.2-1704s21c1
Sequence:CCGGCCACTGTGCTGGCCTAATTAACTCGAGTTAATTAGGCCAGCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153714.2-266s21c1
Sequence:CCGGGGTCCACGAGACTTAACATTTCTCGAGAAATGTTAAGTCTCGTGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153714.2-452s21c1
Sequence:CCGGAGTTTGAGGACCGACTGAAAGCTCGAGCTTTCAGTCGGTCCTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153714.2-503s21c1
Sequence:CCGGATGACAGGATCCTAGAAATTGCTCGAGCAATTTCTAGGATCCTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153714
C10orf67 MISSION shRNA shRNA Plasmid DNA
chromosome 10 open reading frame 67
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153714.1-588s1c1
Sequence:CCGGCATAGCTGTTATCAAAGGAATCTCGAGATTCCTTTGATAACAGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153714.1-529s1c1
Sequence:CCGGCATTATCAACAGAATGAGGATCTCGAGATCCTCATTCTGTTGATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153714.1-1494s1c1
Sequence:CCGGGCCTTAAACTTCTGGACTCAACTCGAGTTGAGTCCAGAAGTTTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153714.2-101s21c1
Sequence:CCGGATGTCATGAGCATAGTTATTACTCGAGTAATAACTATGCTCATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263841    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153714.2-1704s21c1
Sequence:CCGGCCACTGTGCTGGCCTAATTAACTCGAGTTAATTAGGCCAGCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153714.2-266s21c1
Sequence:CCGGGGTCCACGAGACTTAACATTTCTCGAGAAATGTTAAGTCTCGTGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153714.2-452s21c1
Sequence:CCGGAGTTTGAGGACCGACTGAAAGCTCGAGCTTTCAGTCGGTCCTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153714.2-503s21c1
Sequence:CCGGATGACAGGATCCTAGAAATTGCTCGAGCAATTTCTAGGATCCTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153714
C10orf67 MISSION shRNA Lentiviral Transduction Particles
chromosome 10 open reading frame 67
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153714.1-588s1c1
Sequence:CCGGCATAGCTGTTATCAAAGGAATCTCGAGATTCCTTTGATAACAGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153714.1-529s1c1
Sequence:CCGGCATTATCAACAGAATGAGGATCTCGAGATCCTCATTCTGTTGATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153714.1-1494s1c1
Sequence:CCGGGCCTTAAACTTCTGGACTCAACTCGAGTTGAGTCCAGAAGTTTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153714.2-101s21c1
Sequence:CCGGATGTCATGAGCATAGTTATTACTCGAGTAATAACTATGCTCATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263841    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153714.2-1704s21c1
Sequence:CCGGCCACTGTGCTGGCCTAATTAACTCGAGTTAATTAGGCCAGCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153714.2-266s21c1
Sequence:CCGGGGTCCACGAGACTTAACATTTCTCGAGAAATGTTAAGTCTCGTGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153714.2-452s21c1
Sequence:CCGGAGTTTGAGGACCGACTGAAAGCTCGAGCTTTCAGTCGGTCCTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153714.2-503s21c1
Sequence:CCGGATGACAGGATCCTAGAAATTGCTCGAGCAATTTCTAGGATCCTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks