EMAIL THIS PAGE TO A FRIEND

C10orf68

chromosome 10 open reading frame 68

78 Gene Product Result for
Synonyms: dJ1104A8.1
Species: Human C10orf68(79741)
UniProtKB ID: Q9H943, B0QZ71, Q08AN7, Q8N7T7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024688 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024688 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024688 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024688 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024688 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013521 predicted 1825
2 SASI_Hs01_00013522 predicted 544
3 SASI_Hs01_00013523 predicted 1848
4 SASI_Hs02_00357131 predicted 1562
5 SASI_Hs01_00013524 predicted 508
6 SASI_Hs02_00357132 predicted 1620
7 SASI_Hs01_00013526 predicted 1747
8 SASI_Hs01_00013527 predicted 1682
9 SASI_Hs01_00013529 predicted 2093
10 SASI_Hs02_00357133 predicted 2308
11 SASI_Hs01_00013525 predicted 1631
12 SASI_Hs01_00013528 predicted 1943
13 SASI_Hs01_00013530 predicted 1480
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024688
C10orf68 MISSION shRNA Bacterial Glycerol Stock
chromosome 10 open reading frame 68
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024688.2-1375s21c1
Sequence:CCGGGTTTCCCTGGGCCTGATATAGCTCGAGCTATATCAGGCCCAGGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024688.2-1326s21c1
Sequence:CCGGGCTTTGGGAAGACGCTTATTACTCGAGTAATAAGCGTCTTCCCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024688.2-1252s21c1
Sequence:CCGGGCGAATCTCAAACGAAGAAACCTCGAGGTTTCTTCGTTTGAGATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024688.2-1516s21c1
Sequence:CCGGATGCAATTAAGACGCAGTTAACTCGAGTTAACTGCGTCTTAATTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024688.2-954s21c1
Sequence:CCGGGGACGTAGCATACCAGATAAACTCGAGTTTATCTGGTATGCTACGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168662    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024688.1-2487s1c1
Sequence:CCGGGCTGGAAATACAGTGGATCAACTCGAGTTGATCCACTGTATTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024688.1-516s1c1
Sequence:CCGGGCTCATAATGAAGTACCAAATCTCGAGATTTGGTACTTCATTATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167455    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024688.1-2388s1c1
Sequence:CCGGGCAACATGACAAATTCAGAAACTCGAGTTTCTGAATTTGTCATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024688.1-1638s1c1
Sequence:CCGGGAGACTGATAAGAACTTCTTTCTCGAGAAAGAAGTTCTTATCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024688
C10orf68 MISSION shRNA shRNA Plasmid DNA
chromosome 10 open reading frame 68
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024688.2-1375s21c1
Sequence:CCGGGTTTCCCTGGGCCTGATATAGCTCGAGCTATATCAGGCCCAGGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024688.2-1326s21c1
Sequence:CCGGGCTTTGGGAAGACGCTTATTACTCGAGTAATAAGCGTCTTCCCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024688.2-1252s21c1
Sequence:CCGGGCGAATCTCAAACGAAGAAACCTCGAGGTTTCTTCGTTTGAGATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024688.2-1516s21c1
Sequence:CCGGATGCAATTAAGACGCAGTTAACTCGAGTTAACTGCGTCTTAATTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024688.2-954s21c1
Sequence:CCGGGGACGTAGCATACCAGATAAACTCGAGTTTATCTGGTATGCTACGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168662    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024688.1-2487s1c1
Sequence:CCGGGCTGGAAATACAGTGGATCAACTCGAGTTGATCCACTGTATTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024688.1-516s1c1
Sequence:CCGGGCTCATAATGAAGTACCAAATCTCGAGATTTGGTACTTCATTATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167455    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024688.1-2388s1c1
Sequence:CCGGGCAACATGACAAATTCAGAAACTCGAGTTTCTGAATTTGTCATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024688.1-1638s1c1
Sequence:CCGGGAGACTGATAAGAACTTCTTTCTCGAGAAAGAAGTTCTTATCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024688
C10orf68 MISSION shRNA Lentiviral Transduction Particles
chromosome 10 open reading frame 68
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024688.2-1375s21c1
Sequence:CCGGGTTTCCCTGGGCCTGATATAGCTCGAGCTATATCAGGCCCAGGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024688.2-1326s21c1
Sequence:CCGGGCTTTGGGAAGACGCTTATTACTCGAGTAATAAGCGTCTTCCCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024688.2-1252s21c1
Sequence:CCGGGCGAATCTCAAACGAAGAAACCTCGAGGTTTCTTCGTTTGAGATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024688.2-1516s21c1
Sequence:CCGGATGCAATTAAGACGCAGTTAACTCGAGTTAACTGCGTCTTAATTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024688.2-954s21c1
Sequence:CCGGGGACGTAGCATACCAGATAAACTCGAGTTTATCTGGTATGCTACGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168662    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024688.1-2487s1c1
Sequence:CCGGGCTGGAAATACAGTGGATCAACTCGAGTTGATCCACTGTATTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024688.1-516s1c1
Sequence:CCGGGCTCATAATGAAGTACCAAATCTCGAGATTTGGTACTTCATTATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167455    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024688.1-2388s1c1
Sequence:CCGGGCAACATGACAAATTCAGAAACTCGAGTTTCTGAATTTGTCATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024688.1-1638s1c1
Sequence:CCGGGAGACTGATAAGAACTTCTTTCTCGAGAAAGAAGTTCTTATCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks