EMAIL THIS PAGE TO A FRIEND

C10orf71

chromosome 10 open reading frame 71

20 Gene Product Result for
Species: Human C10orf71(118461)
UniProtKB ID: Q711Q0, A0AVL8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_060969 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_060969 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_060969 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_199459 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199459 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199459 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU105011 MISSION® esiRNA esiRNA human C10orf71 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199459 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199459 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188042 predicted 752
2 SASI_Hs01_00188043 predicted 767
3 SASI_Hs01_00188044 predicted 2090
4 SASI_Hs01_00188045 predicted 506
5 SASI_Hs01_00188046 predicted 640
6 SASI_Hs01_00188047 predicted 1048
7 SASI_Hs01_00188048 predicted 1874
8 SASI_Hs01_00188049 predicted 1787
9 SASI_Hs01_00188050 predicted 1889
10 SASI_Hs02_00372867 predicted 1502
11 SASI_Hs01_00188041 predicted 761
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_060969
C10orf71 MISSION shRNA Bacterial Glycerol Stock
chromosome 10 open reading frame 71
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000129559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_060969.2-1893s1c1
Sequence:CCGGCGAGACAGCTACAAGTCCAAACTCGAGTTTGGACTTGTAGCTGTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060969.2-3513s1c1
Sequence:CCGGCCAGGTTTCAAGAGTCACTTTCTCGAGAAAGTGACTCTTGAAACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_060969
C10orf71 MISSION shRNA shRNA Plasmid DNA
chromosome 10 open reading frame 71
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000129559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_060969.2-1893s1c1
Sequence:CCGGCGAGACAGCTACAAGTCCAAACTCGAGTTTGGACTTGTAGCTGTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060969.2-3513s1c1
Sequence:CCGGCCAGGTTTCAAGAGTCACTTTCTCGAGAAAGTGACTCTTGAAACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_060969
C10orf71 MISSION shRNA Lentiviral Transduction Particles
chromosome 10 open reading frame 71
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000129559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_060969.2-1893s1c1
Sequence:CCGGCGAGACAGCTACAAGTCCAAACTCGAGTTTGGACTTGTAGCTGTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060969.2-3513s1c1
Sequence:CCGGCCAGGTTTCAAGAGTCACTTTCTCGAGAAAGTGACTCTTGAAACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199459
C10orf71 MISSION shRNA Bacterial Glycerol Stock
chromosome 10 open reading frame 71
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199459.2-2478s1c1
Sequence:CCGGCATAAAGTCCAGAAGGCAGTACTCGAGTACTGCCTTCTGGACTTTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199459.2-1919s1c1
Sequence:CCGGCTAGAGGTAAGGTTGATGGAACTCGAGTTCCATCAACCTTACCTCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146429    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199459.2-2738s1c1
Sequence:CCGGCTCACTTGTAAGCTCCTTGATCTCGAGATCAAGGAGCTTACAAGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199459.2-2093s1c1
Sequence:CCGGCAGACAGCTATCTAACTCTTACTCGAGTAAGAGTTAGATAGCTGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199459.2-2449s1c1
Sequence:CCGGCATCAACACATACTTAGCCTTCTCGAGAAGGCTAAGTATGTGTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199459.3-761s21c1
Sequence:CCGGCCAAAGTATCAACACTAATTACTCGAGTAATTAGTGTTGATACTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199459
C10orf71 MISSION shRNA shRNA Plasmid DNA
chromosome 10 open reading frame 71
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199459.2-2478s1c1
Sequence:CCGGCATAAAGTCCAGAAGGCAGTACTCGAGTACTGCCTTCTGGACTTTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199459.2-1919s1c1
Sequence:CCGGCTAGAGGTAAGGTTGATGGAACTCGAGTTCCATCAACCTTACCTCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146429    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199459.2-2738s1c1
Sequence:CCGGCTCACTTGTAAGCTCCTTGATCTCGAGATCAAGGAGCTTACAAGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199459.2-2093s1c1
Sequence:CCGGCAGACAGCTATCTAACTCTTACTCGAGTAAGAGTTAGATAGCTGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199459.2-2449s1c1
Sequence:CCGGCATCAACACATACTTAGCCTTCTCGAGAAGGCTAAGTATGTGTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199459.3-761s21c1
Sequence:CCGGCCAAAGTATCAACACTAATTACTCGAGTAATTAGTGTTGATACTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199459
C10orf71 MISSION shRNA Lentiviral Transduction Particles
chromosome 10 open reading frame 71
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199459.2-2478s1c1
Sequence:CCGGCATAAAGTCCAGAAGGCAGTACTCGAGTACTGCCTTCTGGACTTTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199459.2-1919s1c1
Sequence:CCGGCTAGAGGTAAGGTTGATGGAACTCGAGTTCCATCAACCTTACCTCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146429    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199459.2-2738s1c1
Sequence:CCGGCTCACTTGTAAGCTCCTTGATCTCGAGATCAAGGAGCTTACAAGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199459.2-2093s1c1
Sequence:CCGGCAGACAGCTATCTAACTCTTACTCGAGTAAGAGTTAGATAGCTGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199459.2-2449s1c1
Sequence:CCGGCATCAACACATACTTAGCCTTCTCGAGAAGGCTAAGTATGTGTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199459.3-761s21c1
Sequence:CCGGCCAAAGTATCAACACTAATTACTCGAGTAATTAGTGTTGATACTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)