EMAIL THIS PAGE TO A FRIEND

C10orf76

chromosome 10 open reading frame 76

163 Gene Product Result for
Species: Human C10orf76(79591)
UniProtKB ID: Q5T2E6, Q2TB87, Q9H8Z9
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024541 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024541 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024541 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120121 MISSION® esiRNA esiRNA human C10orf76 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024541 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024541 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356834 predicted 816
2 SASI_Hs01_00101345 predicted 1918
3 SASI_Hs02_00356835 predicted 258
4 SASI_Hs01_00101348 predicted 1737
5 SASI_Hs02_00356836 predicted 1027
6 SASI_Hs02_00356837 predicted 377
7 SASI_Hs02_00356838 predicted 1061
8 SASI_Hs02_00356839 predicted 837
9 SASI_Hs02_00356840 predicted 415
10 SASI_Hs02_00356841 predicted 1001
11 SASI_Hs01_00101346 predicted 1104
12 SASI_Hs01_00101347 predicted 239
13 SASI_Hs01_00101349 predicted 778
14 SASI_Hs01_00101350 predicted 968
15 SASI_Hs01_00101351 predicted 311
16 SASI_Hs01_00101352 predicted 708
17 SASI_Hs01_00101353 predicted 370
18 SASI_Hs01_00101354 predicted 1132
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024541
C10orf76 MISSION shRNA Bacterial Glycerol Stock
chromosome 10 open reading frame 76
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024541.2-862s21c1
Sequence:CCGGGAGTACAACAGGCAGTATAAACTCGAGTTTATACTGCCTGTTGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024541.2-2471s21c1
Sequence:CCGGGCTGTAGCTACTGACTAATTTCTCGAGAAATTAGTCAGTAGCTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024541.2-649s21c1
Sequence:CCGGGTAATGATCAACAGCATATTTCTCGAGAAATATGCTGTTGATCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131043    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024541.1-2299s1c1
Sequence:CCGGCCTCTGAAATAGCTGCTGCTTCTCGAGAAGCAGCAGCTATTTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024541.1-73s1c1
Sequence:CCGGCTGGACCTGATGGTAGAGTTTCTCGAGAAACTCTACCATCAGGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130976    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024541.1-1913s1c1
Sequence:CCGGCCTACTTTGCTGGTTCCCTTTCTCGAGAAAGGGAACCAGCAAAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024541.1-691s1c1
Sequence:CCGGGCCTTCTTCAAAGAGCTGGTTCTCGAGAACCAGCTCTTTGAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129715    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024541.1-249s1c1
Sequence:CCGGCCTTATGTCAAATGAGACTGTCTCGAGACAGTCTCATTTGACATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024541.1-1318s1c1
Sequence:CCGGGCTCAGATTTAGGGTAAGATACTCGAGTATCTTACCCTAAATCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024541.1-556s1c1
Sequence:CCGGGCTGTGAATCACATATCCCAACTCGAGTTGGGATATGTGATTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024541.1-408s1c1
Sequence:CCGGCCAGAGCTTTGACAACCTCTACTCGAGTAGAGGTTGTCAAAGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024541
C10orf76 MISSION shRNA shRNA Plasmid DNA
chromosome 10 open reading frame 76
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024541.2-862s21c1
Sequence:CCGGGAGTACAACAGGCAGTATAAACTCGAGTTTATACTGCCTGTTGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024541.2-2471s21c1
Sequence:CCGGGCTGTAGCTACTGACTAATTTCTCGAGAAATTAGTCAGTAGCTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024541.2-649s21c1
Sequence:CCGGGTAATGATCAACAGCATATTTCTCGAGAAATATGCTGTTGATCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131043    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024541.1-2299s1c1
Sequence:CCGGCCTCTGAAATAGCTGCTGCTTCTCGAGAAGCAGCAGCTATTTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024541.1-73s1c1
Sequence:CCGGCTGGACCTGATGGTAGAGTTTCTCGAGAAACTCTACCATCAGGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130976    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024541.1-1913s1c1
Sequence:CCGGCCTACTTTGCTGGTTCCCTTTCTCGAGAAAGGGAACCAGCAAAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024541.1-691s1c1
Sequence:CCGGGCCTTCTTCAAAGAGCTGGTTCTCGAGAACCAGCTCTTTGAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129715    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024541.1-249s1c1
Sequence:CCGGCCTTATGTCAAATGAGACTGTCTCGAGACAGTCTCATTTGACATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024541.1-1318s1c1
Sequence:CCGGGCTCAGATTTAGGGTAAGATACTCGAGTATCTTACCCTAAATCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024541.1-556s1c1
Sequence:CCGGGCTGTGAATCACATATCCCAACTCGAGTTGGGATATGTGATTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024541.1-408s1c1
Sequence:CCGGCCAGAGCTTTGACAACCTCTACTCGAGTAGAGGTTGTCAAAGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024541
C10orf76 MISSION shRNA Lentiviral Transduction Particles
chromosome 10 open reading frame 76
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024541.2-862s21c1
Sequence:CCGGGAGTACAACAGGCAGTATAAACTCGAGTTTATACTGCCTGTTGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024541.2-2471s21c1
Sequence:CCGGGCTGTAGCTACTGACTAATTTCTCGAGAAATTAGTCAGTAGCTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024541.2-649s21c1
Sequence:CCGGGTAATGATCAACAGCATATTTCTCGAGAAATATGCTGTTGATCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131043    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024541.1-2299s1c1
Sequence:CCGGCCTCTGAAATAGCTGCTGCTTCTCGAGAAGCAGCAGCTATTTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024541.1-73s1c1
Sequence:CCGGCTGGACCTGATGGTAGAGTTTCTCGAGAAACTCTACCATCAGGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130976    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024541.1-1913s1c1
Sequence:CCGGCCTACTTTGCTGGTTCCCTTTCTCGAGAAAGGGAACCAGCAAAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024541.1-691s1c1
Sequence:CCGGGCCTTCTTCAAAGAGCTGGTTCTCGAGAACCAGCTCTTTGAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129715    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024541.1-249s1c1
Sequence:CCGGCCTTATGTCAAATGAGACTGTCTCGAGACAGTCTCATTTGACATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024541.1-1318s1c1
Sequence:CCGGGCTCAGATTTAGGGTAAGATACTCGAGTATCTTACCCTAAATCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024541.1-556s1c1
Sequence:CCGGGCTGTGAATCACATATCCCAACTCGAGTTGGGATATGTGATTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024541.1-408s1c1
Sequence:CCGGCCAGAGCTTTGACAACCTCTACTCGAGTAGAGGTTGTCAAAGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks