EMAIL THIS PAGE TO A FRIEND

C10orf82

chromosome 10 open reading frame 82

65 Gene Product Result for
Species: Human C10orf82(143379)
UniProtKB ID: Q8WW14, B3KUM9, D3DRC3
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144661 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144661 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144661 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144661 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144661 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120702 predicted 321
2 SASI_Hs01_00120703 predicted 482
3 SASI_Hs01_00120704 predicted 749
4 SASI_Hs01_00120705 predicted 715
5 SASI_Hs01_00120706 predicted 718
6 SASI_Hs01_00120707 predicted 407
7 SASI_Hs01_00120710 predicted 252
8 SASI_Hs02_00364542 predicted 492
9 SASI_Hs02_00364543 predicted 615
10 SASI_Hs02_00364544 predicted 532
11 SASI_Hs01_00120708 predicted 518
12 SASI_Hs01_00120709 predicted 526
13 SASI_Hs01_00120711 predicted 508
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144661
C10orf82 MISSION shRNA Bacterial Glycerol Stock
chromosome 10 open reading frame 82
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144661.2-333s1c1
Sequence:CCGGGCAAATATGTAAAGAAACCTCCTCGAGGAGGTTTCTTTACATATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144661.2-454s1c1
Sequence:CCGGCTACAAGGACTTCCTGGAGATCTCGAGATCTCCAGGAAGTCCTTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172280    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144661.2-763s1c1
Sequence:CCGGCGCAAAGTATGCAGAAGGCTACTCGAGTAGCCTTCTGCATACTTTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144661.2-486s21c1
Sequence:CCGGCCAAGAAGGCACATCTGAAACCTCGAGGTTTCAGATGTGCCTTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144661.2-517s21c1
Sequence:CCGGGTGAGGAGAAATGTCTCTTTCCTCGAGGAAAGAGACATTTCTCCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144661.2-705s21c1
Sequence:CCGGGTGCTCAGAGGCCAAGTATACCTCGAGGTATACTTGGCCTCTGAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144661.2-319s21c1
Sequence:CCGGCCTGATCCTGGAATGCAAATACTCGAGTATTTGCATTCCAGGATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144661.2-88s21c1
Sequence:CCGGGCCAATCACACCAGGCTATAGCTCGAGCTATAGCCTGGTGTGATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144661
C10orf82 MISSION shRNA shRNA Plasmid DNA
chromosome 10 open reading frame 82
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144661.2-333s1c1
Sequence:CCGGGCAAATATGTAAAGAAACCTCCTCGAGGAGGTTTCTTTACATATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144661.2-454s1c1
Sequence:CCGGCTACAAGGACTTCCTGGAGATCTCGAGATCTCCAGGAAGTCCTTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172280    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144661.2-763s1c1
Sequence:CCGGCGCAAAGTATGCAGAAGGCTACTCGAGTAGCCTTCTGCATACTTTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144661.2-486s21c1
Sequence:CCGGCCAAGAAGGCACATCTGAAACCTCGAGGTTTCAGATGTGCCTTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144661.2-517s21c1
Sequence:CCGGGTGAGGAGAAATGTCTCTTTCCTCGAGGAAAGAGACATTTCTCCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144661.2-705s21c1
Sequence:CCGGGTGCTCAGAGGCCAAGTATACCTCGAGGTATACTTGGCCTCTGAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144661.2-319s21c1
Sequence:CCGGCCTGATCCTGGAATGCAAATACTCGAGTATTTGCATTCCAGGATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144661.2-88s21c1
Sequence:CCGGGCCAATCACACCAGGCTATAGCTCGAGCTATAGCCTGGTGTGATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144661
C10orf82 MISSION shRNA Lentiviral Transduction Particles
chromosome 10 open reading frame 82
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144661.2-333s1c1
Sequence:CCGGGCAAATATGTAAAGAAACCTCCTCGAGGAGGTTTCTTTACATATTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144661.2-454s1c1
Sequence:CCGGCTACAAGGACTTCCTGGAGATCTCGAGATCTCCAGGAAGTCCTTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172280    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144661.2-763s1c1
Sequence:CCGGCGCAAAGTATGCAGAAGGCTACTCGAGTAGCCTTCTGCATACTTTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144661.2-486s21c1
Sequence:CCGGCCAAGAAGGCACATCTGAAACCTCGAGGTTTCAGATGTGCCTTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144661.2-517s21c1
Sequence:CCGGGTGAGGAGAAATGTCTCTTTCCTCGAGGAAAGAGACATTTCTCCTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144661.2-705s21c1
Sequence:CCGGGTGCTCAGAGGCCAAGTATACCTCGAGGTATACTTGGCCTCTGAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144661.2-319s21c1
Sequence:CCGGCCTGATCCTGGAATGCAAATACTCGAGTATTTGCATTCCAGGATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144661.2-88s21c1
Sequence:CCGGGCCAATCACACCAGGCTATAGCTCGAGCTATAGCCTGGTGTGATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)