EMAIL THIS PAGE TO A FRIEND

C10orf85

chromosome 10 open reading frame 85

41 Gene Product Result for
Species: Human C10orf85(404216)
UniProtKB ID: Q8N1V8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA037933 Anti-C10orf85 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012711 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012711 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012711 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012711 Rosetta Predictions human pricing
XR_041622 Rosetta Predictions human pricing
XR_041623 Rosetta Predictions human pricing
XR_041624 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012711 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213768 predicted 891
2 SASI_Hs01_00213769 predicted 984
3 SASI_Hs01_00213770 predicted 557
4 SASI_Hs01_00213771 predicted 1164
5 SASI_Hs01_00213772 predicted 1159
6 SASI_Hs01_00213773 predicted 731
7 SASI_Hs01_00213774 predicted 1174
8 SASI_Hs01_00213775 predicted 872
9 SASI_Hs01_00213776 predicted 978
10 SASI_Hs01_00213777 predicted 1101
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041622 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00528972 predicted 200
2 SASI_Hs02_00528973 predicted 201
3 SASI_Hs02_00528974 predicted 199
4 SASI_Hs02_00528975 predicted 206
5 SASI_Hs02_00528976 predicted 7
6 SASI_Hs02_00528977 predicted 25
7 SASI_Hs02_00528978 predicted 286
8 SASI_Hs02_00528979 predicted 156
9 SASI_Hs02_00528980 predicted 154
10 SASI_Hs02_00528981 predicted 423
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041623 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00528982 predicted 199
2 SASI_Hs02_00528983 predicted 203
3 SASI_Hs02_00528984 predicted 202
4 SASI_Hs02_00528985 predicted 202
5 SASI_Hs02_00528986 predicted 10
6 SASI_Hs02_00528987 predicted 17
7 SASI_Hs02_00528988 predicted 290
8 SASI_Hs02_00528989 predicted 157
9 SASI_Hs02_00528990 predicted 155
10 SASI_Hs02_00528991 predicted 429
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041624 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00528992 predicted 194
2 SASI_Hs02_00528993 predicted 200
3 SASI_Hs02_00528994 predicted 195
4 SASI_Hs02_00528995 predicted 200
5 SASI_Hs02_00528996 predicted 2
6 SASI_Hs02_00528997 predicted 25
7 SASI_Hs02_00528998 predicted 294
8 SASI_Hs02_00528999 predicted 163
9 SASI_Hs02_00529000 predicted 151
10 SASI_Hs02_00529001 predicted 427
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012711
C10orf85 MISSION shRNA Bacterial Glycerol Stock
chromosome 10 open reading frame 85
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000183438    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012711.1-1441s1c1
Sequence:CCGGGCAGTGAATTTGGTTGTTCTTCTCGAGAAGAACAACCAAATTCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178912    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012711.1-1374s1c1
Sequence:CCGGCCGGAATTTGAATCCTGCAATCTCGAGATTGCAGGATTCAAATTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012711.1-305s1c1
Sequence:CCGGGAATCTTGAGTGTCCAGATCACTCGAGTGATCTGGACACTCAAGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012711
C10orf85 MISSION shRNA shRNA Plasmid DNA
chromosome 10 open reading frame 85
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000183438    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012711.1-1441s1c1
Sequence:CCGGGCAGTGAATTTGGTTGTTCTTCTCGAGAAGAACAACCAAATTCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178912    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012711.1-1374s1c1
Sequence:CCGGCCGGAATTTGAATCCTGCAATCTCGAGATTGCAGGATTCAAATTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012711.1-305s1c1
Sequence:CCGGGAATCTTGAGTGTCCAGATCACTCGAGTGATCTGGACACTCAAGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012711
C10orf85 MISSION shRNA Lentiviral Transduction Particles
chromosome 10 open reading frame 85
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000183438    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012711.1-1441s1c1
Sequence:CCGGGCAGTGAATTTGGTTGTTCTTCTCGAGAAGAACAACCAAATTCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178912    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012711.1-1374s1c1
Sequence:CCGGCCGGAATTTGAATCCTGCAATCTCGAGATTGCAGGATTCAAATTCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012711.1-305s1c1
Sequence:CCGGGAATCTTGAGTGTCCAGATCACTCGAGTGATCTGGACACTCAAGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)