EMAIL THIS PAGE TO A FRIEND

C10orf88

chromosome 10 open reading frame 88

62 Gene Product Result for
Species: Human C10orf88(80007)
UniProtKB ID: Q9H8K7, Q0P6C6, Q8N597
Gene ID:
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024942 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024942 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024942 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU057831 MISSION® esiRNA esiRNA human C10orf88 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024942 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024942 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054532 predicted 840
2 SASI_Hs01_00054533 predicted 1457
3 SASI_Hs01_00054534 predicted 1394
4 SASI_Hs01_00054536 predicted 1182
5 SASI_Hs01_00054537 predicted 1087
6 SASI_Hs01_00054538 predicted 1332
7 SASI_Hs01_00054539 predicted 1557
8 SASI_Hs01_00054541 predicted 1640
9 SASI_Hs02_00357586 predicted 1402
10 SASI_Hs02_00357587 predicted 924
11 SASI_Hs01_00054535 predicted 1448
12 SASI_Hs01_00054540 predicted 1406
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024942
VALIDATED
C10orf88 MISSION shRNA Bacterial Glycerol Stock
chromosome 10 open reading frame 88
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024942.1-958s1c1
Sequence:CCGGGAGTGTAAAGTTATGCCTCAACTCGAGTTGAGGCATAACTTTACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167762    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024942.1-1997s1c1
Sequence:CCGGGTAGGAAAGTAAACATCAGAACTCGAGTTCTGATGTTTACTTTCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167715    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024942.1-1314s1c1
Sequence:CCGGGATTGCTTTGTTACTGGATTTCTCGAGAAATCCAGTAACAAAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_024942.3-1408s21c1
Sequence:CCGGGATTACATTGATCAGCGAATACTCGAGTATTCGCTGATCAATGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024942.3-858s21c1
Sequence:CCGGTAGGTGTCAGCAGCGGAATTGCTCGAGCAATTCCGCTGCTGACACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024942.3-1327s21c1
Sequence:CCGGGGAATGGAAGAGCAATCTATTCTCGAGAATAGATTGCTCTTCCATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263888    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_024942.3-2427s21c1
Sequence:CCGGTATGCATTGAAGGGTGATATACTCGAGTATATCACCCTTCAATGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_024942.3-954s21c1
Sequence:CCGGATCTACCTTAGGAACCTTAAACTCGAGTTTAAGGTTCCTAAGGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024942
VALIDATED
C10orf88 MISSION shRNA shRNA Plasmid DNA
chromosome 10 open reading frame 88
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024942.1-958s1c1
Sequence:CCGGGAGTGTAAAGTTATGCCTCAACTCGAGTTGAGGCATAACTTTACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167762    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024942.1-1997s1c1
Sequence:CCGGGTAGGAAAGTAAACATCAGAACTCGAGTTCTGATGTTTACTTTCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167715    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024942.1-1314s1c1
Sequence:CCGGGATTGCTTTGTTACTGGATTTCTCGAGAAATCCAGTAACAAAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_024942.3-1408s21c1
Sequence:CCGGGATTACATTGATCAGCGAATACTCGAGTATTCGCTGATCAATGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024942.3-858s21c1
Sequence:CCGGTAGGTGTCAGCAGCGGAATTGCTCGAGCAATTCCGCTGCTGACACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024942.3-1327s21c1
Sequence:CCGGGGAATGGAAGAGCAATCTATTCTCGAGAATAGATTGCTCTTCCATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263888    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_024942.3-2427s21c1
Sequence:CCGGTATGCATTGAAGGGTGATATACTCGAGTATATCACCCTTCAATGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_024942.3-954s21c1
Sequence:CCGGATCTACCTTAGGAACCTTAAACTCGAGTTTAAGGTTCCTAAGGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024942
VALIDATED
C10orf88 MISSION shRNA Lentiviral Transduction Particles
chromosome 10 open reading frame 88
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024942.1-958s1c1
Sequence:CCGGGAGTGTAAAGTTATGCCTCAACTCGAGTTGAGGCATAACTTTACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167762    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024942.1-1997s1c1
Sequence:CCGGGTAGGAAAGTAAACATCAGAACTCGAGTTCTGATGTTTACTTTCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167715    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024942.1-1314s1c1
Sequence:CCGGGATTGCTTTGTTACTGGATTTCTCGAGAAATCCAGTAACAAAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_024942.3-1408s21c1
Sequence:CCGGGATTACATTGATCAGCGAATACTCGAGTATTCGCTGATCAATGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024942.3-858s21c1
Sequence:CCGGTAGGTGTCAGCAGCGGAATTGCTCGAGCAATTCCGCTGCTGACACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024942.3-1327s21c1
Sequence:CCGGGGAATGGAAGAGCAATCTATTCTCGAGAATAGATTGCTCTTCCATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263888    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_024942.3-2427s21c1
Sequence:CCGGTATGCATTGAAGGGTGATATACTCGAGTATATCACCCTTCAATGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_024942.3-954s21c1
Sequence:CCGGATCTACCTTAGGAACCTTAAACTCGAGTTTAAGGTTCCTAAGGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks