EMAIL THIS PAGE TO A FRIEND

C10orf90

chromosome 10 open reading frame 90

47 Gene Product Result for
Synonyms: FATS bA422P15.2
Species: Human C10orf90(118611)
UniProtKB ID: Q96M02, B9EIQ9, Q5JRP6, Q5T023, Q8NCV5, Q8WU75
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004298 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004298 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004298 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU089911 MISSION® esiRNA esiRNA human C10orf90 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004298 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004298 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052868 predicted 1618
2 SASI_Hs01_00052869 predicted 422
3 SASI_Hs02_00304489 predicted 1053
4 SASI_Hs01_00052870 predicted 901
5 SASI_Hs01_00052872 predicted 1830
6 SASI_Hs01_00052874 predicted 899
7 SASI_Hs01_00052875 predicted 281
8 SASI_Hs01_00052876 predicted 995
9 SASI_Hs01_00052877 predicted 415
10 SASI_Hs02_00304490 predicted 265
11 SASI_Hs01_00052871 predicted 1863
12 SASI_Hs01_00052873 predicted 1850
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004298
C10orf90 MISSION shRNA Bacterial Glycerol Stock
chromosome 10 open reading frame 90
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004298.2-1811s21c1
Sequence:CCGGCAAACGCCTGCAAGATCTTTGCTCGAGCAAAGATCTTGCAGGCGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004298.2-422s21c1
Sequence:CCGGGCGTTACTTCCGGGCAGATTACTCGAGTAATCTGCCCGGAAGTAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168410    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004298.2-2648s1c1
Sequence:CCGGGCCAGTTATGCAAATGCCAAACTCGAGTTTGGCATTTGCATAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004298.2-274s1c1
Sequence:CCGGCATAGTCATCTCCCAGATGATCTCGAGATCATCTGGGAGATGACTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004298.2-2018s1c1
Sequence:CCGGGATAACTTGTTCAAACCCAAACTCGAGTTTGGGTTTGAACAAGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004298.2-1535s1c1
Sequence:CCGGCGACATCAAAGCTTCCTGAAACTCGAGTTTCAGGAAGCTTTGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004298.2-898s1c1
Sequence:CCGGGTGTCCAGATTCAATCTATTACTCGAGTAATAGATTGAATCTGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004298
C10orf90 MISSION shRNA shRNA Plasmid DNA
chromosome 10 open reading frame 90
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004298.2-1811s21c1
Sequence:CCGGCAAACGCCTGCAAGATCTTTGCTCGAGCAAAGATCTTGCAGGCGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004298.2-422s21c1
Sequence:CCGGGCGTTACTTCCGGGCAGATTACTCGAGTAATCTGCCCGGAAGTAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168410    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004298.2-2648s1c1
Sequence:CCGGGCCAGTTATGCAAATGCCAAACTCGAGTTTGGCATTTGCATAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004298.2-274s1c1
Sequence:CCGGCATAGTCATCTCCCAGATGATCTCGAGATCATCTGGGAGATGACTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004298.2-2018s1c1
Sequence:CCGGGATAACTTGTTCAAACCCAAACTCGAGTTTGGGTTTGAACAAGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004298.2-1535s1c1
Sequence:CCGGCGACATCAAAGCTTCCTGAAACTCGAGTTTCAGGAAGCTTTGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004298.2-898s1c1
Sequence:CCGGGTGTCCAGATTCAATCTATTACTCGAGTAATAGATTGAATCTGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004298
C10orf90 MISSION shRNA Lentiviral Transduction Particles
chromosome 10 open reading frame 90
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004298.2-1811s21c1
Sequence:CCGGCAAACGCCTGCAAGATCTTTGCTCGAGCAAAGATCTTGCAGGCGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004298.2-422s21c1
Sequence:CCGGGCGTTACTTCCGGGCAGATTACTCGAGTAATCTGCCCGGAAGTAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168410    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004298.2-2648s1c1
Sequence:CCGGGCCAGTTATGCAAATGCCAAACTCGAGTTTGGCATTTGCATAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004298.2-274s1c1
Sequence:CCGGCATAGTCATCTCCCAGATGATCTCGAGATCATCTGGGAGATGACTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004298.2-2018s1c1
Sequence:CCGGGATAACTTGTTCAAACCCAAACTCGAGTTTGGGTTTGAACAAGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004298.2-1535s1c1
Sequence:CCGGCGACATCAAAGCTTCCTGAAACTCGAGTTTCAGGAAGCTTTGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004298.2-898s1c1
Sequence:CCGGGTGTCCAGATTCAATCTATTACTCGAGTAATAGATTGAATCTGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks