EMAIL THIS PAGE TO A FRIEND

C10orf91

chromosome 10 open reading frame 91

17 Gene Product Result for
Synonyms: RP11-432J24.4 bA432J24.4
Species: Human C10orf91(170393)
UniProtKB ID: Q5T1B1, Q8N0T7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173541 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173541 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173541 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173541 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173541 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182658 predicted 230
2 SASI_Hs01_00182659 predicted 219
3 SASI_Hs01_00182660 predicted 434
4 SASI_Hs01_00182661 predicted 434
5 SASI_Hs01_00182662 predicted 424
6 SASI_Hs01_00182663 predicted 358
7 SASI_Hs01_00182664 predicted 222
8 SASI_Hs01_00182665 predicted 258
9 SASI_Hs01_00182666 predicted 433
10 SASI_Hs02_00368338 predicted 377
11 SASI_Hs01_00182667 predicted 212
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173541
C10orf91 MISSION shRNA Bacterial Glycerol Stock
chromosome 10 open reading frame 91
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173541.1-186s1c1
Sequence:CCGGCCAGGATAACTCAGTACACATCTCGAGATGTGTACTGAGTTATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167999    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173541.1-817s1c1
Sequence:CCGGCCGAGAAGAACGTTAACAGTACTCGAGTACTGTTAACGTTCTTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173541.1-228s1c1
Sequence:CCGGCAGAGAAACCTCAGACAAGAACTCGAGTTCTTGTCTGAGGTTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173541.1-457s1c1
Sequence:CCGGGTCTGTTAGTCAGGGTTTCAGCTCGAGCTGAAACCCTGACTAACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172282    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173541.1-803s1c1
Sequence:CCGGCGGTTAATTACAGCCCGAGAACTCGAGTTCTCGGGCTGTAATTAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173541.2-231s21c1
Sequence:CCGGCGTCGCCCATTTCTCATCAAGCTCGAGCTTGATGAGAAATGGGCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173541.2-260s21c1
Sequence:CCGGCAGACCACGAGAGCGCTTTCTCTCGAGAGAAAGCGCTCTCGTGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173541.2-116s21c1
Sequence:CCGGTGGACGCATGACCAGGATTCTCTCGAGAGAATCCTGGTCATGCGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173541
C10orf91 MISSION shRNA shRNA Plasmid DNA
chromosome 10 open reading frame 91
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173541.1-186s1c1
Sequence:CCGGCCAGGATAACTCAGTACACATCTCGAGATGTGTACTGAGTTATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167999    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173541.1-817s1c1
Sequence:CCGGCCGAGAAGAACGTTAACAGTACTCGAGTACTGTTAACGTTCTTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173541.1-228s1c1
Sequence:CCGGCAGAGAAACCTCAGACAAGAACTCGAGTTCTTGTCTGAGGTTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173541.1-457s1c1
Sequence:CCGGGTCTGTTAGTCAGGGTTTCAGCTCGAGCTGAAACCCTGACTAACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172282    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173541.1-803s1c1
Sequence:CCGGCGGTTAATTACAGCCCGAGAACTCGAGTTCTCGGGCTGTAATTAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173541.2-231s21c1
Sequence:CCGGCGTCGCCCATTTCTCATCAAGCTCGAGCTTGATGAGAAATGGGCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173541.2-260s21c1
Sequence:CCGGCAGACCACGAGAGCGCTTTCTCTCGAGAGAAAGCGCTCTCGTGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173541.2-116s21c1
Sequence:CCGGTGGACGCATGACCAGGATTCTCTCGAGAGAATCCTGGTCATGCGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173541
C10orf91 MISSION shRNA Lentiviral Transduction Particles
chromosome 10 open reading frame 91
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173541.1-186s1c1
Sequence:CCGGCCAGGATAACTCAGTACACATCTCGAGATGTGTACTGAGTTATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167999    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173541.1-817s1c1
Sequence:CCGGCCGAGAAGAACGTTAACAGTACTCGAGTACTGTTAACGTTCTTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173541.1-228s1c1
Sequence:CCGGCAGAGAAACCTCAGACAAGAACTCGAGTTCTTGTCTGAGGTTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173541.1-457s1c1
Sequence:CCGGGTCTGTTAGTCAGGGTTTCAGCTCGAGCTGAAACCCTGACTAACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172282    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173541.1-803s1c1
Sequence:CCGGCGGTTAATTACAGCCCGAGAACTCGAGTTCTCGGGCTGTAATTAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173541.2-231s21c1
Sequence:CCGGCGTCGCCCATTTCTCATCAAGCTCGAGCTTGATGAGAAATGGGCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173541.2-260s21c1
Sequence:CCGGCAGACCACGAGAGCGCTTTCTCTCGAGAGAAAGCGCTCTCGTGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173541.2-116s21c1
Sequence:CCGGTGGACGCATGACCAGGATTCTCTCGAGAGAATCCTGGTCATGCGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks