EMAIL THIS PAGE TO A FRIEND

C10orf99

chromosome 10 open reading frame 99

20 Gene Product Result for
Synonyms: UNQ1833
Species: Human C10orf99(387695)
UniProtKB ID: Q6UWK7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207373 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207373 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207373 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207373 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207373 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373974 predicted 471
2 SASI_Hs01_00131685 predicted 599
3 SASI_Hs01_00131686 predicted 393
4 SASI_Hs01_00131689 predicted 576
5 SASI_Hs02_00373975 predicted 474
6 SASI_Hs01_00131690 predicted 394
7 SASI_Hs02_00373976 predicted 477
8 SASI_Hs02_00373977 predicted 606
9 SASI_Hs02_00373978 predicted 453
10 SASI_Hs02_00373979 predicted 221
11 SASI_Hs01_00131687 predicted 750
12 SASI_Hs01_00131688 predicted 754
13 SASI_Hs01_00131691 predicted 592
14 SASI_Hs01_00131692 predicted 765
15 SASI_Hs01_00131693 predicted 745
16 SASI_Hs01_00131694 predicted 192
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207373
C10orf99 MISSION shRNA Bacterial Glycerol Stock
chromosome 10 open reading frame 99
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207373.1-202s1c1
Sequence:CCGGGACATCATGTGAGGCTCTGTACTCGAGTACAGAGCCTCACATGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207373.1-95s1c1
Sequence:CCGGCATCTTCTCCACAGAAGGGAACTCGAGTTCCCTTCTGTGGAGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207373.1-197s1c1
Sequence:CCGGGAAAGGACATCATGTGAGGCTCTCGAGAGCCTCACATGATGTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207373.1-73s1c1
Sequence:CCGGGTATCCTGCTTCTCTGCTTCTCTCGAGAGAAGCAGAGAAGCAGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168522    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207373.1-467s1c1
Sequence:CCGGGCCATCAACTTTCAGAGCTATCTCGAGATAGCTCTGAAAGTTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207373.1-185s1c1
Sequence:CCGGCTCAACAAACCTGAAAGGACACTCGAGTGTCCTTTCAGGTTTGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207373.1-180s1c1
Sequence:CCGGCCCAACTCAACAAACCTGAAACTCGAGTTTCAGGTTTGTTGAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207373.1-218s1c1
Sequence:CCGGCTGTAAACCATGCAAGCTTGACTCGAGTCAAGCTTGCATGGTTTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207373.1-204s1c1
Sequence:CCGGCATCATGTGAGGCTCTGTAAACTCGAGTTTACAGAGCCTCACATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207373
C10orf99 MISSION shRNA shRNA Plasmid DNA
chromosome 10 open reading frame 99
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207373.1-202s1c1
Sequence:CCGGGACATCATGTGAGGCTCTGTACTCGAGTACAGAGCCTCACATGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207373.1-95s1c1
Sequence:CCGGCATCTTCTCCACAGAAGGGAACTCGAGTTCCCTTCTGTGGAGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207373.1-197s1c1
Sequence:CCGGGAAAGGACATCATGTGAGGCTCTCGAGAGCCTCACATGATGTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207373.1-73s1c1
Sequence:CCGGGTATCCTGCTTCTCTGCTTCTCTCGAGAGAAGCAGAGAAGCAGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168522    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207373.1-467s1c1
Sequence:CCGGGCCATCAACTTTCAGAGCTATCTCGAGATAGCTCTGAAAGTTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207373.1-185s1c1
Sequence:CCGGCTCAACAAACCTGAAAGGACACTCGAGTGTCCTTTCAGGTTTGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207373.1-180s1c1
Sequence:CCGGCCCAACTCAACAAACCTGAAACTCGAGTTTCAGGTTTGTTGAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207373.1-218s1c1
Sequence:CCGGCTGTAAACCATGCAAGCTTGACTCGAGTCAAGCTTGCATGGTTTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207373.1-204s1c1
Sequence:CCGGCATCATGTGAGGCTCTGTAAACTCGAGTTTACAGAGCCTCACATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207373
C10orf99 MISSION shRNA Lentiviral Transduction Particles
chromosome 10 open reading frame 99
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207373.1-202s1c1
Sequence:CCGGGACATCATGTGAGGCTCTGTACTCGAGTACAGAGCCTCACATGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207373.1-95s1c1
Sequence:CCGGCATCTTCTCCACAGAAGGGAACTCGAGTTCCCTTCTGTGGAGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207373.1-197s1c1
Sequence:CCGGGAAAGGACATCATGTGAGGCTCTCGAGAGCCTCACATGATGTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207373.1-73s1c1
Sequence:CCGGGTATCCTGCTTCTCTGCTTCTCTCGAGAGAAGCAGAGAAGCAGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168522    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207373.1-467s1c1
Sequence:CCGGGCCATCAACTTTCAGAGCTATCTCGAGATAGCTCTGAAAGTTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207373.1-185s1c1
Sequence:CCGGCTCAACAAACCTGAAAGGACACTCGAGTGTCCTTTCAGGTTTGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207373.1-180s1c1
Sequence:CCGGCCCAACTCAACAAACCTGAAACTCGAGTTTCAGGTTTGTTGAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207373.1-218s1c1
Sequence:CCGGCTGTAAACCATGCAAGCTTGACTCGAGTCAAGCTTGCATGGTTTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207373.1-204s1c1
Sequence:CCGGCATCATGTGAGGCTCTGTAAACTCGAGTTTACAGAGCCTCACATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks