EMAIL THIS PAGE TO A FRIEND

C11orf16

chromosome 11 open reading frame 16

21 Gene Product Result for
UniProtKB ID: Q9NQ32, Q53FB2, Q8N6Y9
Gene ID:
chicken(423053) chromosome 5 open reading frame, human C11orf16
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2106115 Anti-C11ORF16 antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB1303004 ANTI-CK016 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020643 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020643 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020643 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU134471 MISSION® esiRNA esiRNA human C11orf16 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020643 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020643 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353621 predicted 1463
2 SASI_Hs01_00208144 predicted 1210
3 SASI_Hs01_00208145 predicted 857
4 SASI_Hs01_00208146 predicted 1507
5 SASI_Hs01_00208147 predicted 1319
6 SASI_Hs01_00208148 predicted 1558
7 SASI_Hs01_00208150 predicted 474
8 SASI_Hs01_00208151 predicted 623
9 SASI_Hs01_00208152 predicted 547
10 SASI_Hs02_00353622 predicted 1520
11 SASI_Hs01_00208143 predicted 1515
12 SASI_Hs01_00208149 predicted 1398
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020643
C11orf16 MISSION shRNA Bacterial Glycerol Stock
chromosome 11 open reading frame 16
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020643.1-644s1c1
Sequence:CCGGCCCAGAGAGCATCAAAGGAAACTCGAGTTTCCTTTGATGCTCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020643.1-1310s1c1
Sequence:CCGGCCAACATCTGCAAAGAAGAAACTCGAGTTTCTTCTTTGCAGATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134210    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020643.1-1617s1c1
Sequence:CCGGCAGTCAAATAACCACCAGTATCTCGAGATACTGGTGGTTATTTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020643.1-676s1c1
Sequence:CCGGGTTCATTTCTGGAATGGCAAACTCGAGTTTGCCATTCCAGAAATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134150    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020643.1-1607s1c1
Sequence:CCGGCCACAGGTAACAGTCAAATAACTCGAGTTATTTGACTGTTACCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020643.1-684s1c1
Sequence:CCGGCTGGAATGGCAAAGCTGCTAACTCGAGTTAGCAGCTTTGCCATTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020643
C11orf16 MISSION shRNA shRNA Plasmid DNA
chromosome 11 open reading frame 16
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020643.1-644s1c1
Sequence:CCGGCCCAGAGAGCATCAAAGGAAACTCGAGTTTCCTTTGATGCTCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020643.1-1310s1c1
Sequence:CCGGCCAACATCTGCAAAGAAGAAACTCGAGTTTCTTCTTTGCAGATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134210    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020643.1-1617s1c1
Sequence:CCGGCAGTCAAATAACCACCAGTATCTCGAGATACTGGTGGTTATTTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020643.1-676s1c1
Sequence:CCGGGTTCATTTCTGGAATGGCAAACTCGAGTTTGCCATTCCAGAAATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134150    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020643.1-1607s1c1
Sequence:CCGGCCACAGGTAACAGTCAAATAACTCGAGTTATTTGACTGTTACCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020643.1-684s1c1
Sequence:CCGGCTGGAATGGCAAAGCTGCTAACTCGAGTTAGCAGCTTTGCCATTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020643
C11orf16 MISSION shRNA Lentiviral Transduction Particles
chromosome 11 open reading frame 16
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020643.1-644s1c1
Sequence:CCGGCCCAGAGAGCATCAAAGGAAACTCGAGTTTCCTTTGATGCTCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020643.1-1310s1c1
Sequence:CCGGCCAACATCTGCAAAGAAGAAACTCGAGTTTCTTCTTTGCAGATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134210    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020643.1-1617s1c1
Sequence:CCGGCAGTCAAATAACCACCAGTATCTCGAGATACTGGTGGTTATTTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020643.1-676s1c1
Sequence:CCGGGTTCATTTCTGGAATGGCAAACTCGAGTTTGCCATTCCAGAAATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134150    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020643.1-1607s1c1
Sequence:CCGGCCACAGGTAACAGTCAAATAACTCGAGTTATTTGACTGTTACCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020643.1-684s1c1
Sequence:CCGGCTGGAATGGCAAAGCTGCTAACTCGAGTTAGCAGCTTTGCCATTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks