EMAIL THIS PAGE TO A FRIEND

C11orf21

chromosome 11 open reading frame 21

46 Gene Product Result for
Species: Human C11orf21(29125)
UniProtKB ID: Q9P2W6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001142946 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001142946 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001142946 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_042066 Rosetta Predictions human pricing
XR_042067 Rosetta Predictions human pricing
XR_042068 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042066 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00532797 predicted 257
2 SASI_Hs02_00532798 predicted 255
3 SASI_Hs02_00532799 predicted 254
4 SASI_Hs02_00532800 predicted 369
5 SASI_Hs02_00532801 predicted 208
6 SASI_Hs02_00532802 predicted 243
7 SASI_Hs02_00532803 predicted 240
8 SASI_Hs02_00532804 predicted 204
9 SASI_Hs02_00532805 predicted 210
10 SASI_Hs02_00532806 predicted 218
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042067 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00532807 predicted 252
2 SASI_Hs02_00532808 predicted 257
3 SASI_Hs02_00532809 predicted 250
4 SASI_Hs02_00532810 predicted 377
5 SASI_Hs02_00532811 predicted 213
6 SASI_Hs02_00532812 predicted 250
7 SASI_Hs02_00532813 predicted 239
8 SASI_Hs02_00532814 predicted 195
9 SASI_Hs02_00532815 predicted 215
10 SASI_Hs02_00532816 predicted 216
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042068 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00532817 predicted 252
2 SASI_Hs02_00532818 predicted 255
3 SASI_Hs02_00532819 predicted 255
4 SASI_Hs02_00532820 predicted 370
5 SASI_Hs02_00532821 predicted 208
6 SASI_Hs02_00532822 predicted 250
7 SASI_Hs02_00532823 predicted 243
8 SASI_Hs02_00532824 predicted 195
9 SASI_Hs02_00532825 predicted 214
10 SASI_Hs02_00532826 predicted 217
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001142946
C11orf21 MISSION shRNA Bacterial Glycerol Stock
chromosome 11 open reading frame 21
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000269833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001142946.1-1930s21c1
Sequence:CCGGCCTTGCCATACTCCTACAAATCTCGAGATTTGTAGGAGTATGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142946.1-270s21c1
Sequence:CCGGCATCTCAAAGTGGCGTCGAACCTCGAGGTTCGACGCCACTTTGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142946.1-457s21c1
Sequence:CCGGCTGCTGCTGTCTCAGTTTACCCTCGAGGGTAAACTGAGACAGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142946.1-160s21c1
Sequence:CCGGATTGTCTCTCTCCAACCTTGACTCGAGTCAAGGTTGGAGAGAGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001142946
C11orf21 MISSION shRNA shRNA Plasmid DNA
chromosome 11 open reading frame 21
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000269833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001142946.1-1930s21c1
Sequence:CCGGCCTTGCCATACTCCTACAAATCTCGAGATTTGTAGGAGTATGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142946.1-270s21c1
Sequence:CCGGCATCTCAAAGTGGCGTCGAACCTCGAGGTTCGACGCCACTTTGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142946.1-457s21c1
Sequence:CCGGCTGCTGCTGTCTCAGTTTACCCTCGAGGGTAAACTGAGACAGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142946.1-160s21c1
Sequence:CCGGATTGTCTCTCTCCAACCTTGACTCGAGTCAAGGTTGGAGAGAGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001142946
C11orf21 MISSION shRNA Lentiviral Transduction Particles
chromosome 11 open reading frame 21
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000269833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001142946.1-1930s21c1
Sequence:CCGGCCTTGCCATACTCCTACAAATCTCGAGATTTGTAGGAGTATGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142946.1-270s21c1
Sequence:CCGGCATCTCAAAGTGGCGTCGAACCTCGAGGTTCGACGCCACTTTGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142946.1-457s21c1
Sequence:CCGGCTGCTGCTGTCTCAGTTTACCCTCGAGGGTAAACTGAGACAGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142946.1-160s21c1
Sequence:CCGGATTGTCTCTCTCCAACCTTGACTCGAGTCAAGGTTGGAGAGAGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks