EMAIL THIS PAGE TO A FRIEND

C11orf24

chromosome 11 open reading frame 24

38 Gene Product Result for
Synonyms: DM4E3
Species: Human C11orf24(53838)
UniProtKB ID: Q96F05, Q9H2K4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022338 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022338 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022338 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU135971 MISSION® esiRNA esiRNA human C11orf24 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022338 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022338 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355620 predicted 557
2 SASI_Hs01_00076159 predicted 1709
3 SASI_Hs01_00076160 predicted 451
4 SASI_Hs01_00076161 predicted 1202
5 SASI_Hs01_00076162 predicted 663
6 SASI_Hs02_00355621 predicted 567
7 SASI_Hs01_00076164 predicted 497
8 SASI_Hs01_00076166 predicted 705
9 SASI_Hs01_00076167 predicted 473
10 SASI_Hs01_00076168 predicted 1848
11 SASI_Hs01_00076163 predicted 527
12 SASI_Hs01_00076165 predicted 1672
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022338
VALIDATED
C11orf24 MISSION shRNA Bacterial Glycerol Stock
chromosome 11 open reading frame 24
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022338.3-656s21c1
Sequence:CCGGGCCCACCTCAACTCTATGGAACTCGAGTTCCATAGAGTTGAGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022338.3-1744s21c1
Sequence:CCGGCCAGGTGGACTACTTAATCAACTCGAGTTGATTAAGTAGTCCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022338.3-518s21c1
Sequence:CCGGCGCAACTTTGTCCCTAACAAACTCGAGTTTGTTAGGGACAAAGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_022338.3-1234s21c1
Sequence:CCGGGCCTGTGGTTAACACAACAAACTCGAGTTTGTTGTGTTAACCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022338.3-1902s21c1
Sequence:CCGGCCAGATGCTTAAACACATTTACTCGAGTAAATGTGTTTAAGCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_022338.2-1854s1c1
Sequence:CCGGCCAGATGCTTAAACACATTTACTCGAGTAAATGTGTTTAAGCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_022338.2-1186s1c1
Sequence:CCGGGCCTGTGGTTAACACAACAAACTCGAGTTTGTTGTGTTAACCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_022338.2-1696s1c1
Sequence:CCGGCCAGGTGGACTACTTAATCAACTCGAGTTGATTAAGTAGTCCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022338.2-608s1c1
Sequence:CCGGGCCCACCTCAACTCTATGGAACTCGAGTTCCATAGAGTTGAGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_022338.2-470s1c1
Sequence:CCGGCGCAACTTTGTCCCTAACAAACTCGAGTTTGTTAGGGACAAAGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022338
VALIDATED
C11orf24 MISSION shRNA shRNA Plasmid DNA
chromosome 11 open reading frame 24
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022338.3-656s21c1
Sequence:CCGGGCCCACCTCAACTCTATGGAACTCGAGTTCCATAGAGTTGAGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022338.3-1744s21c1
Sequence:CCGGCCAGGTGGACTACTTAATCAACTCGAGTTGATTAAGTAGTCCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022338.3-518s21c1
Sequence:CCGGCGCAACTTTGTCCCTAACAAACTCGAGTTTGTTAGGGACAAAGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_022338.3-1234s21c1
Sequence:CCGGGCCTGTGGTTAACACAACAAACTCGAGTTTGTTGTGTTAACCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022338.3-1902s21c1
Sequence:CCGGCCAGATGCTTAAACACATTTACTCGAGTAAATGTGTTTAAGCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_022338.2-1854s1c1
Sequence:CCGGCCAGATGCTTAAACACATTTACTCGAGTAAATGTGTTTAAGCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_022338.2-1186s1c1
Sequence:CCGGGCCTGTGGTTAACACAACAAACTCGAGTTTGTTGTGTTAACCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_022338.2-1696s1c1
Sequence:CCGGCCAGGTGGACTACTTAATCAACTCGAGTTGATTAAGTAGTCCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022338.2-608s1c1
Sequence:CCGGGCCCACCTCAACTCTATGGAACTCGAGTTCCATAGAGTTGAGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_022338.2-470s1c1
Sequence:CCGGCGCAACTTTGTCCCTAACAAACTCGAGTTTGTTAGGGACAAAGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022338
VALIDATED
C11orf24 MISSION shRNA Lentiviral Transduction Particles
chromosome 11 open reading frame 24
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022338.3-656s21c1
Sequence:CCGGGCCCACCTCAACTCTATGGAACTCGAGTTCCATAGAGTTGAGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022338.3-1744s21c1
Sequence:CCGGCCAGGTGGACTACTTAATCAACTCGAGTTGATTAAGTAGTCCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022338.3-518s21c1
Sequence:CCGGCGCAACTTTGTCCCTAACAAACTCGAGTTTGTTAGGGACAAAGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_022338.3-1234s21c1
Sequence:CCGGGCCTGTGGTTAACACAACAAACTCGAGTTTGTTGTGTTAACCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022338.3-1902s21c1
Sequence:CCGGCCAGATGCTTAAACACATTTACTCGAGTAAATGTGTTTAAGCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_022338.2-1854s1c1
Sequence:CCGGCCAGATGCTTAAACACATTTACTCGAGTAAATGTGTTTAAGCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_022338.2-1186s1c1
Sequence:CCGGGCCTGTGGTTAACACAACAAACTCGAGTTTGTTGTGTTAACCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_022338.2-1696s1c1
Sequence:CCGGCCAGGTGGACTACTTAATCAACTCGAGTTGATTAAGTAGTCCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022338.2-608s1c1
Sequence:CCGGGCCCACCTCAACTCTATGGAACTCGAGTTCCATAGAGTTGAGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_022338.2-470s1c1
Sequence:CCGGCGCAACTTTGTCCCTAACAAACTCGAGTTTGTTAGGGACAAAGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks