EMAIL THIS PAGE TO A FRIEND

C11orf30

chromosome 11 open reading frame 30

147 Gene Product Result for
Synonyms: EMSY
Gene ID:
chicken(419090) chromosome 1 open reading frame, human C11orf30
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020193 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020193 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020193 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU065461 MISSION® esiRNA esiRNA human C11orf30 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020193 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020193 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229639 predicted 482
2 SASI_Hs02_00353114 predicted 2578
3 SASI_Hs01_00229642 predicted 2622
4 SASI_Hs01_00229643 predicted 3977
5 SASI_Hs01_00229645 predicted 3912
6 SASI_Hs01_00229646 predicted 2458
7 SASI_Hs01_00229647 predicted 411
8 SASI_Hs01_00229648 predicted 2833
9 SASI_Hs02_00353115 predicted 343
10 SASI_Hs02_00353116 predicted 3894
11 SASI_Hs01_00229640 predicted 1367
12 SASI_Hs01_00229641 predicted 370
13 SASI_Hs01_00229644 predicted 3856
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020193
VALIDATED
C11orf30 MISSION shRNA Bacterial Glycerol Stock
chromosome 11 open reading frame 30
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020193.2-2392s1c1
Sequence:CCGGCCCACTATTGACCTGAGTCAACTCGAGTTGACTCAGGTCAATAGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020193.2-1667s1c1
Sequence:CCGGGCAGTAATATAGTTTCTGGAACTCGAGTTCCAGAAACTATATTACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020193.2-329s1c1
Sequence:CCGGCCGCCTTTACTGTAACAGCTACTCGAGTAGCTGTTACAGTAAAGGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020193.2-2198s1c1
Sequence:CCGGCCCAGCCTGTAGTTCATGTAACTCGAGTTACATGAACTACAGGCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020193.2-208s1c1
Sequence:CCGGGCAGTAAACGATGAACGGTTACTCGAGTAACCGTTCATCGTTTACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_020193.3-1744s21c1
Sequence:CCGGCTACGAGTGGTAGCATCATTACTCGAGTAATGATGCTACCACTCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020193.3-386s21c1
Sequence:GTACCGGTAATATGTCTGGACCTAATAGCTCGAGCTATTAGGTCCAGACATATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020193.3-4806s21c1
Sequence:GTACCGGCGTACTCCTTCTGACAAATTTCTCGAGAAATTTGTCAGAAGGAGTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_020193.3-2407s21c1
Sequence:CCGGAGACTAGCCCTACCATAATTTCTCGAGAAATTATGGTAGGGCTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020193.3-2840s21c1
Sequence:CCGGCATTATGCAGCAGGCATTAAGCTCGAGCTTAATGCCTGCTGCATAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020193
VALIDATED
C11orf30 MISSION shRNA shRNA Plasmid DNA
chromosome 11 open reading frame 30
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020193.2-2392s1c1
Sequence:CCGGCCCACTATTGACCTGAGTCAACTCGAGTTGACTCAGGTCAATAGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020193.2-1667s1c1
Sequence:CCGGGCAGTAATATAGTTTCTGGAACTCGAGTTCCAGAAACTATATTACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020193.2-329s1c1
Sequence:CCGGCCGCCTTTACTGTAACAGCTACTCGAGTAGCTGTTACAGTAAAGGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020193.2-2198s1c1
Sequence:CCGGCCCAGCCTGTAGTTCATGTAACTCGAGTTACATGAACTACAGGCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020193.2-208s1c1
Sequence:CCGGGCAGTAAACGATGAACGGTTACTCGAGTAACCGTTCATCGTTTACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_020193.3-1744s21c1
Sequence:CCGGCTACGAGTGGTAGCATCATTACTCGAGTAATGATGCTACCACTCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020193.3-386s21c1
Sequence:GTACCGGTAATATGTCTGGACCTAATAGCTCGAGCTATTAGGTCCAGACATATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020193.3-4806s21c1
Sequence:GTACCGGCGTACTCCTTCTGACAAATTTCTCGAGAAATTTGTCAGAAGGAGTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_020193.3-2407s21c1
Sequence:CCGGAGACTAGCCCTACCATAATTTCTCGAGAAATTATGGTAGGGCTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020193.3-2840s21c1
Sequence:CCGGCATTATGCAGCAGGCATTAAGCTCGAGCTTAATGCCTGCTGCATAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020193
VALIDATED
C11orf30 MISSION shRNA Lentiviral Transduction Particles
chromosome 11 open reading frame 30
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020193.2-2392s1c1
Sequence:CCGGCCCACTATTGACCTGAGTCAACTCGAGTTGACTCAGGTCAATAGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020193.2-1667s1c1
Sequence:CCGGGCAGTAATATAGTTTCTGGAACTCGAGTTCCAGAAACTATATTACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020193.2-329s1c1
Sequence:CCGGCCGCCTTTACTGTAACAGCTACTCGAGTAGCTGTTACAGTAAAGGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020193.2-2198s1c1
Sequence:CCGGCCCAGCCTGTAGTTCATGTAACTCGAGTTACATGAACTACAGGCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020193.2-208s1c1
Sequence:CCGGGCAGTAAACGATGAACGGTTACTCGAGTAACCGTTCATCGTTTACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_020193.3-1744s21c1
Sequence:CCGGCTACGAGTGGTAGCATCATTACTCGAGTAATGATGCTACCACTCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020193.3-386s21c1
Sequence:GTACCGGTAATATGTCTGGACCTAATAGCTCGAGCTATTAGGTCCAGACATATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020193.3-4806s21c1
Sequence:GTACCGGCGTACTCCTTCTGACAAATTTCTCGAGAAATTTGTCAGAAGGAGTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_020193.3-2407s21c1
Sequence:CCGGAGACTAGCCCTACCATAATTTCTCGAGAAATTATGGTAGGGCTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020193.3-2840s21c1
Sequence:CCGGCATTATGCAGCAGGCATTAAGCTCGAGCTTAATGCCTGCTGCATAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)