EMAIL THIS PAGE TO A FRIEND

C11orf31

chromosome 11 open reading frame 31

23 Gene Product Result for
Synonyms: C17orf10 SELH
Species: Human C11orf31(280636)
Gene ID:
Human(280636) Summary: This gene encodes a selenoprotein, which contains a selenocysteine (Sec) residue at its active site. The selenocysteine is encoded by the UGA codon that normally signals translation termination. The 3' UTR of selenoprotein genes have a common stem-loop structure, the sec insertion sequence (SECIS), that is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. The exact function of this gene is not known, however, selenoproteins are thought to be responsible for most biomedical effects of dietary selenium. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0117 AQUA Peptide LEAPELPV[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_170746 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_170746 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_170746 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_170746 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170746 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367712 predicted 793
2 SASI_Hs02_00367713 predicted 444
3 SASI_Hs01_00225495 predicted 666
4 SASI_Hs01_00225496 predicted 780
5 SASI_Hs01_00225497 predicted 739
6 SASI_Hs02_00367714 predicted 617
7 SASI_Hs01_00225500 predicted 799
8 SASI_Hs01_00225501 predicted 622
9 SASI_Hs01_00225502 predicted 781
10 SASI_Hs01_00225503 predicted 531
11 SASI_Hs01_00225494 predicted 735
12 SASI_Hs01_00225498 predicted 658
13 SASI_Hs01_00225499 predicted 671
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170746
VALIDATED
C11orf31 MISSION shRNA Bacterial Glycerol Stock
chromosome 11 open reading frame 31
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170746.2-545s21c1
Sequence:CCGGGTAAAGGTGAACCCGACGAAGCTCGAGCTTCGTCGGGTTCACCTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170746.2-789s21c1
Sequence:CCGGGCCAAACTTCAGTCATGATCCCTCGAGGGATCATGACTGAAGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170746.2-623s21c1
Sequence:CCGGCTCTGGACTGGGATTAAGAAGCTCGAGCTTCTTAATCCCAGTCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170746.2-967s21c1
Sequence:CCGGAGCCTTGTGGAGTTGGTAGTCCTCGAGGACTACCAACTCCACAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_170746.2-831s1c1
Sequence:CCGGGCCAGAAATGAAGGTTCAGTTCTCGAGAACTGAACCTTCATTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170746.2-832s1c1
Sequence:CCGGCCAGAAATGAAGGTTCAGTTACTCGAGTAACTGAACCTTCATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_170746.2-694s1c1
Sequence:CCGGGTTGAAGAAGTACCTGTCGTACTCGAGTACGACAGGTACTTCTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_170746.2-452s1c1
Sequence:CCGGGTTGTTATCGAGCATTGCACTCTCGAGAGTGCAATGCTCGATAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170746.2-622s1c1
Sequence:CCGGGCTCTGGACTGGGATTAAGAACTCGAGTTCTTAATCCCAGTCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170746.2-650s1c1
Sequence:CCGGCCACGCAAACTCAAATTCCCTCTCGAGAGGGAATTTGAGTTTGCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170746
VALIDATED
C11orf31 MISSION shRNA shRNA Plasmid DNA
chromosome 11 open reading frame 31
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170746.2-545s21c1
Sequence:CCGGGTAAAGGTGAACCCGACGAAGCTCGAGCTTCGTCGGGTTCACCTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170746.2-789s21c1
Sequence:CCGGGCCAAACTTCAGTCATGATCCCTCGAGGGATCATGACTGAAGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170746.2-623s21c1
Sequence:CCGGCTCTGGACTGGGATTAAGAAGCTCGAGCTTCTTAATCCCAGTCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170746.2-967s21c1
Sequence:CCGGAGCCTTGTGGAGTTGGTAGTCCTCGAGGACTACCAACTCCACAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_170746.2-831s1c1
Sequence:CCGGGCCAGAAATGAAGGTTCAGTTCTCGAGAACTGAACCTTCATTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170746.2-832s1c1
Sequence:CCGGCCAGAAATGAAGGTTCAGTTACTCGAGTAACTGAACCTTCATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_170746.2-694s1c1
Sequence:CCGGGTTGAAGAAGTACCTGTCGTACTCGAGTACGACAGGTACTTCTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_170746.2-452s1c1
Sequence:CCGGGTTGTTATCGAGCATTGCACTCTCGAGAGTGCAATGCTCGATAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170746.2-622s1c1
Sequence:CCGGGCTCTGGACTGGGATTAAGAACTCGAGTTCTTAATCCCAGTCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170746.2-650s1c1
Sequence:CCGGCCACGCAAACTCAAATTCCCTCTCGAGAGGGAATTTGAGTTTGCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170746
VALIDATED
C11orf31 MISSION shRNA Lentiviral Transduction Particles
chromosome 11 open reading frame 31
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170746.2-545s21c1
Sequence:CCGGGTAAAGGTGAACCCGACGAAGCTCGAGCTTCGTCGGGTTCACCTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170746.2-789s21c1
Sequence:CCGGGCCAAACTTCAGTCATGATCCCTCGAGGGATCATGACTGAAGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170746.2-623s21c1
Sequence:CCGGCTCTGGACTGGGATTAAGAAGCTCGAGCTTCTTAATCCCAGTCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170746.2-967s21c1
Sequence:CCGGAGCCTTGTGGAGTTGGTAGTCCTCGAGGACTACCAACTCCACAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_170746.2-831s1c1
Sequence:CCGGGCCAGAAATGAAGGTTCAGTTCTCGAGAACTGAACCTTCATTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170746.2-832s1c1
Sequence:CCGGCCAGAAATGAAGGTTCAGTTACTCGAGTAACTGAACCTTCATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_170746.2-694s1c1
Sequence:CCGGGTTGAAGAAGTACCTGTCGTACTCGAGTACGACAGGTACTTCTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_170746.2-452s1c1
Sequence:CCGGGTTGTTATCGAGCATTGCACTCTCGAGAGTGCAATGCTCGATAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170746.2-622s1c1
Sequence:CCGGGCTCTGGACTGGGATTAAGAACTCGAGTTCTTAATCCCAGTCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170746.2-650s1c1
Sequence:CCGGCCACGCAAACTCAAATTCCCTCTCGAGAGGGAATTTGAGTTTGCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks